Incidental Mutation 'R8045:Topors'
ID618700
Institutional Source Beutler Lab
Gene Symbol Topors
Ensembl Gene ENSMUSG00000036822
Gene Nametopoisomerase I binding, arginine/serine-rich
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #R8045 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location40259601-40269850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40261988 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 432 (V432A)
Ref Sequence ENSEMBL: ENSMUSP00000046843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042575]
Predicted Effect probably benign
Transcript: ENSMUST00000042575
AA Change: V432A

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046843
Gene: ENSMUSG00000036822
AA Change: V432A

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 29 44 N/A INTRINSIC
RING 104 142 7.27e-7 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 465 478 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 589 610 N/A INTRINSIC
low complexity region 620 696 N/A INTRINSIC
low complexity region 756 780 N/A INTRINSIC
low complexity region 837 860 N/A INTRINSIC
low complexity region 877 894 N/A INTRINSIC
Meta Mutation Damage Score 0.0983 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which is serine and arginine rich, and contains a RING-type zinc finger domain. It is highly expressed in the testis, and functions as an ubiquitin-protein E3 ligase. Mutations in this gene are associated with retinitis pigmentosa type 31. Alternatively spliced transcript variants, encoding different isoforms, have been observed for this locus. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,730,919 D265V probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Anks1b A G 10: 90,680,860 I906V probably benign Het
Arhgap29 C A 3: 122,007,562 silent Het
Casz1 A G 4: 148,932,779 D175G probably damaging Het
Ccdc142 T C 6: 83,103,426 L406P probably damaging Het
Ccdc148 A G 2: 59,002,071 probably null Het
Ccdc175 C T 12: 72,155,902 probably benign Het
Cebpz A G 17: 78,932,156 I612T probably damaging Het
Clcn1 T C 6: 42,290,694 Y137H probably damaging Het
Clint1 T A 11: 45,890,739 I212N possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Crnkl1 G A 2: 145,932,931 T29M probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Disp1 T C 1: 183,089,230 Y542C probably damaging Het
Gm15446 A G 5: 109,940,528 T36A probably damaging Het
Gm4788 T A 1: 139,733,505 K535N probably damaging Het
Herc2 T C 7: 56,184,900 C3209R probably damaging Het
Igf2bp2 T A 16: 22,083,978 D117V possibly damaging Het
Lta4h A G 10: 93,469,106 Y257C probably damaging Het
Mamstr T A 7: 45,644,403 L301Q probably damaging Het
Mllt3 A G 4: 87,841,113 S233P probably damaging Het
Myh7b A T 2: 155,613,181 D42V probably benign Het
Ncam1 T C 9: 49,507,436 T855A Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr193 A T 16: 59,110,039 N190K probably benign Het
Olfr680-ps1 A T 7: 105,090,983 S219T probably benign Het
Pde11a G A 2: 76,022,728 L849F probably damaging Het
Prpf38b T C 3: 108,904,034 K505R unknown Het
Rbbp4 A G 4: 129,317,900 S355P probably benign Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Sema6c C T 3: 95,173,224 S943L probably benign Het
Slc27a3 A G 3: 90,387,142 F441L probably damaging Het
Taar2 T C 10: 23,941,488 W309R probably damaging Het
Vmn1r121 T G 7: 21,097,904 S204R probably damaging Het
Wdr20 T A 12: 110,793,319 L213H probably damaging Het
Zfp512b A G 2: 181,584,824 *880R probably null Het
Zfp652 T C 11: 95,749,657 V136A possibly damaging Het
Other mutations in Topors
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Topors APN 4 40262417 missense probably damaging 1.00
IGL01541:Topors APN 4 40262364 missense possibly damaging 0.70
IGL02093:Topors APN 4 40261467 missense probably damaging 0.98
R0039:Topors UTSW 4 40262772 missense probably damaging 1.00
R0483:Topors UTSW 4 40261952 missense probably damaging 0.96
R0645:Topors UTSW 4 40260333 missense unknown
R1413:Topors UTSW 4 40261982 missense probably benign 0.01
R1507:Topors UTSW 4 40261829 missense probably damaging 0.99
R1677:Topors UTSW 4 40261776 missense probably damaging 0.99
R1863:Topors UTSW 4 40262149 nonsense probably null
R1960:Topors UTSW 4 40261044 missense unknown
R2035:Topors UTSW 4 40262879 missense probably damaging 1.00
R2155:Topors UTSW 4 40262790 missense possibly damaging 0.72
R2519:Topors UTSW 4 40261714 nonsense probably null
R3035:Topors UTSW 4 40269673 critical splice donor site probably null
R3037:Topors UTSW 4 40269673 critical splice donor site probably null
R3842:Topors UTSW 4 40262123 missense probably benign 0.01
R4090:Topors UTSW 4 40260794 missense unknown
R4668:Topors UTSW 4 40262669 missense probably damaging 0.98
R4686:Topors UTSW 4 40261694 missense probably benign 0.03
R4694:Topors UTSW 4 40261442 missense possibly damaging 0.94
R4749:Topors UTSW 4 40261015 missense unknown
R5228:Topors UTSW 4 40262367 missense probably damaging 1.00
R5304:Topors UTSW 4 40262541 missense possibly damaging 0.50
R5725:Topors UTSW 4 40261952 missense probably damaging 0.96
R6617:Topors UTSW 4 40261896 nonsense probably null
R6699:Topors UTSW 4 40262300 missense probably damaging 0.97
R6869:Topors UTSW 4 40261201 missense unknown
R7103:Topors UTSW 4 40261706 missense probably benign 0.03
R7319:Topors UTSW 4 40260540 missense unknown
R7543:Topors UTSW 4 40268312 missense probably damaging 0.99
R7545:Topors UTSW 4 40262173 missense possibly damaging 0.91
R7559:Topors UTSW 4 40261401 missense unknown
R7748:Topors UTSW 4 40262654 missense probably damaging 1.00
R7899:Topors UTSW 4 40260356 missense unknown
R8056:Topors UTSW 4 40262221 missense probably benign 0.30
R8221:Topors UTSW 4 40260686 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAGACAGTTCAACAAGTTCCGG -3'
(R):5'- ATGGCAGCTTTTGACCAGC -3'

Sequencing Primer
(F):5'- AACAAGTTCCGGGGTCCTTTCAG -3'
(R):5'- GACCAGCATGCTAATTATGATTGCCC -3'
Posted On2020-01-23