Incidental Mutation 'R8045:Wdr20'
ID618719
Institutional Source Beutler Lab
Gene Symbol Wdr20
Ensembl Gene ENSMUSG00000037957
Gene NameWD repeat domain 20
SynonymsWdr20a, 2310040A13Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R8045 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location110737944-110804238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110793319 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 213 (L213H)
Ref Sequence ENSEMBL: ENSMUSP00000093059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095410] [ENSMUST00000192870] [ENSMUST00000193053] [ENSMUST00000195886]
Predicted Effect probably damaging
Transcript: ENSMUST00000095410
AA Change: L213H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093059
Gene: ENSMUSG00000037957
AA Change: L213H

DomainStartEndE-ValueType
WD40 140 178 2.66e0 SMART
WD40 209 248 4.95e-4 SMART
WD40 251 290 1.47e-6 SMART
WD40 293 382 8.59e-1 SMART
Blast:WD40 464 559 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000192870
SMART Domains Protein: ENSMUSP00000141887
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 89 131 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193053
SMART Domains Protein: ENSMUSP00000141678
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 89 131 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195886
SMART Domains Protein: ENSMUSP00000142157
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 29 71 1e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that functions to preserve and regulate the activity of the USP12-UAF1 deubiquitinating enzyme complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,730,919 D265V probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Anks1b A G 10: 90,680,860 I906V probably benign Het
Casz1 A G 4: 148,932,779 D175G probably damaging Het
Ccdc142 T C 6: 83,103,426 L406P probably damaging Het
Ccdc148 A G 2: 59,002,071 probably null Het
Cebpz A G 17: 78,932,156 I612T probably damaging Het
Clcn1 T C 6: 42,290,694 Y137H probably damaging Het
Clint1 T A 11: 45,890,739 I212N possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Crnkl1 G A 2: 145,932,931 T29M probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Disp1 T C 1: 183,089,230 Y542C probably damaging Het
Gm15446 A G 5: 109,940,528 T36A probably damaging Het
Gm4788 T A 1: 139,733,505 K535N probably damaging Het
Herc2 T C 7: 56,184,900 C3209R probably damaging Het
Igf2bp2 T A 16: 22,083,978 D117V possibly damaging Het
Lta4h A G 10: 93,469,106 Y257C probably damaging Het
Mamstr T A 7: 45,644,403 L301Q probably damaging Het
Mllt3 A G 4: 87,841,113 S233P probably damaging Het
Myh7b A T 2: 155,613,181 D42V probably benign Het
Ncam1 T C 9: 49,507,436 T855A Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr193 A T 16: 59,110,039 N190K probably benign Het
Olfr680-ps1 A T 7: 105,090,983 S219T probably benign Het
Pde11a G A 2: 76,022,728 L849F probably damaging Het
Prpf38b T C 3: 108,904,034 K505R unknown Het
Rbbp4 A G 4: 129,317,900 S355P probably benign Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Sema6c C T 3: 95,173,224 S943L probably benign Het
Slc27a3 A G 3: 90,387,142 F441L probably damaging Het
Taar2 T C 10: 23,941,488 W309R probably damaging Het
Topors A G 4: 40,261,988 V432A probably benign Het
Vmn1r121 T G 7: 21,097,904 S204R probably damaging Het
Zfp512b A G 2: 181,584,824 *880R probably null Het
Zfp652 T C 11: 95,749,657 V136A possibly damaging Het
Other mutations in Wdr20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Wdr20 APN 12 110779449 nonsense probably null
IGL01663:Wdr20 APN 12 110793514 missense probably damaging 1.00
IGL02385:Wdr20 APN 12 110793223 missense probably benign
IGL02710:Wdr20 APN 12 110793110 splice site probably benign
IGL02993:Wdr20 APN 12 110794308 nonsense probably null
R1500:Wdr20 UTSW 12 110794030 missense probably benign
R1897:Wdr20 UTSW 12 110793723 missense probably benign
R2006:Wdr20 UTSW 12 110793568 missense probably damaging 1.00
R3615:Wdr20 UTSW 12 110793939 missense probably benign
R3616:Wdr20 UTSW 12 110793939 missense probably benign
R4023:Wdr20 UTSW 12 110793516 missense probably benign 0.01
R4026:Wdr20 UTSW 12 110793516 missense probably benign 0.01
R4157:Wdr20 UTSW 12 110738174 missense possibly damaging 0.68
R4868:Wdr20 UTSW 12 110738234 missense probably damaging 1.00
R6126:Wdr20 UTSW 12 110794102 missense probably benign
R6282:Wdr20 UTSW 12 110797009 unclassified probably benign
R6867:Wdr20 UTSW 12 110793699 missense probably benign
R7081:Wdr20 UTSW 12 110803450 missense possibly damaging 0.46
R7842:Wdr20 UTSW 12 110738215 missense probably benign 0.01
R7925:Wdr20 UTSW 12 110738215 missense probably benign 0.01
Predicted Primers
Posted On2020-01-23