Incidental Mutation 'R8045:Olfr193'
ID618721
Institutional Source Beutler Lab
Gene Symbol Olfr193
Ensembl Gene ENSMUSG00000060057
Gene Nameolfactory receptor 193
SynonymsOlfr1540-ps1, MOR183-7P, GA_x54KRFPKG5P-55338697-55337768, MOR113-7P, MOR113-7P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8045 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59107924-59111881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59110039 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 190 (N190K)
Ref Sequence ENSEMBL: ENSMUSP00000146393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076262] [ENSMUST00000207935] [ENSMUST00000208455]
Predicted Effect probably benign
Transcript: ENSMUST00000076262
AA Change: N190K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000075611
Gene: ENSMUSG00000060057
AA Change: N190K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-48 PFAM
Pfam:7tm_1 41 290 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207935
Predicted Effect probably benign
Transcript: ENSMUST00000208455
AA Change: N190K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,730,919 D265V probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Anks1b A G 10: 90,680,860 I906V probably benign Het
Arhgap29 C A 3: 122,007,562 silent Het
Casz1 A G 4: 148,932,779 D175G probably damaging Het
Ccdc142 T C 6: 83,103,426 L406P probably damaging Het
Ccdc148 A G 2: 59,002,071 probably null Het
Ccdc175 C T 12: 72,155,902 probably benign Het
Cebpz A G 17: 78,932,156 I612T probably damaging Het
Clcn1 T C 6: 42,290,694 Y137H probably damaging Het
Clint1 T A 11: 45,890,739 I212N possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Crnkl1 G A 2: 145,932,931 T29M probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Disp1 T C 1: 183,089,230 Y542C probably damaging Het
Gm15446 A G 5: 109,940,528 T36A probably damaging Het
Gm4788 T A 1: 139,733,505 K535N probably damaging Het
Herc2 T C 7: 56,184,900 C3209R probably damaging Het
Igf2bp2 T A 16: 22,083,978 D117V possibly damaging Het
Lta4h A G 10: 93,469,106 Y257C probably damaging Het
Mamstr T A 7: 45,644,403 L301Q probably damaging Het
Mllt3 A G 4: 87,841,113 S233P probably damaging Het
Myh7b A T 2: 155,613,181 D42V probably benign Het
Ncam1 T C 9: 49,507,436 T855A Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr680-ps1 A T 7: 105,090,983 S219T probably benign Het
Pde11a G A 2: 76,022,728 L849F probably damaging Het
Prpf38b T C 3: 108,904,034 K505R unknown Het
Rbbp4 A G 4: 129,317,900 S355P probably benign Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Sema6c C T 3: 95,173,224 S943L probably benign Het
Slc27a3 A G 3: 90,387,142 F441L probably damaging Het
Taar2 T C 10: 23,941,488 W309R probably damaging Het
Topors A G 4: 40,261,988 V432A probably benign Het
Vmn1r121 T G 7: 21,097,904 S204R probably damaging Het
Wdr20 T A 12: 110,793,319 L213H probably damaging Het
Zfp512b A G 2: 181,584,824 *880R probably null Het
Zfp652 T C 11: 95,749,657 V136A possibly damaging Het
Other mutations in Olfr193
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Olfr193 APN 16 59110598 missense probably benign
IGL01613:Olfr193 APN 16 59109921 missense probably damaging 1.00
IGL02280:Olfr193 APN 16 59110332 missense probably damaging 1.00
IGL02533:Olfr193 APN 16 59109684 missense probably benign
IGL02544:Olfr193 APN 16 59110144 missense probably damaging 1.00
IGL02576:Olfr193 APN 16 59109771 missense probably benign
IGL02719:Olfr193 APN 16 59110173 missense probably benign 0.01
IGL03215:Olfr193 APN 16 59109962 missense possibly damaging 0.46
IGL03272:Olfr193 APN 16 59110556 missense probably benign 0.01
PIT4802001:Olfr193 UTSW 16 59110601 missense probably benign
R0544:Olfr193 UTSW 16 59110225 missense probably benign 0.03
R0783:Olfr193 UTSW 16 59110169 nonsense probably null
R1070:Olfr193 UTSW 16 59109819 missense probably benign 0.08
R1211:Olfr193 UTSW 16 59110160 missense possibly damaging 0.68
R1662:Olfr193 UTSW 16 59110604 missense probably benign 0.00
R1754:Olfr193 UTSW 16 59110581 missense probably benign 0.03
R1765:Olfr193 UTSW 16 59109755 missense probably damaging 1.00
R1937:Olfr193 UTSW 16 59109794 missense probably benign 0.11
R2875:Olfr193 UTSW 16 59109802 missense probably benign 0.01
R2910:Olfr193 UTSW 16 59110181 missense probably benign 0.00
R2911:Olfr193 UTSW 16 59110181 missense probably benign 0.00
R5084:Olfr193 UTSW 16 59110073 missense possibly damaging 0.90
R5700:Olfr193 UTSW 16 59109993 missense probably damaging 0.99
R7018:Olfr193 UTSW 16 59110607 start codon destroyed probably null 0.98
R7083:Olfr193 UTSW 16 59110037 missense probably damaging 1.00
R7572:Olfr193 UTSW 16 59110430 missense probably damaging 1.00
R7720:Olfr193 UTSW 16 59109771 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCGCACATACATGAAGAGC -3'
(R):5'- AAACCTTTACTCTACCCAGTGATC -3'

Sequencing Primer
(F):5'- CATGAAGAGCAGAGGGCCATAGTAC -3'
(R):5'- CATGACAAATAGACTCTGTGTACGTC -3'
Posted On2020-01-23