Incidental Mutation 'R8046:Itch'
ID618734
Institutional Source Beutler Lab
Gene Symbol Itch
Ensembl Gene ENSMUSG00000027598
Gene Nameitchy, E3 ubiquitin protein ligase
Synonyms8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8046 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155133509-155226855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155210502 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 674 (G674V)
Ref Sequence ENSEMBL: ENSMUSP00000029126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]
PDB Structure Itch E3 ubiquitin ligase WW3 domain [SOLUTION NMR]
Mouse Itch 3rd WW domain complex with the Epstein-Barr virus latent membrane protein 2A derived peptide EEPPPPYED [SOLUTION NMR]
Mouse Itch 3rd domain phosphorylated in T30 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000029126
AA Change: G674V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: G674V

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109685
AA Change: G674V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: G674V

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Meta Mutation Damage Score 0.9643 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G T 5: 76,896,478 D188E probably benign Het
Ahcyl2 T C 6: 29,878,620 L273P probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Angpt1 T C 15: 42,496,356 T227A probably benign Het
Ankle1 C T 8: 71,408,021 T374M probably damaging Het
Arhgap18 T C 10: 26,887,857 V481A probably damaging Het
Astn2 A T 4: 66,266,350 L170* probably null Het
Bms1 T C 6: 118,408,144 T368A probably benign Het
Boll A G 1: 55,346,403 I121T probably damaging Het
Brca1 A C 11: 101,525,470 C613G probably benign Het
Cdk14 T A 5: 5,249,159 I65F possibly damaging Het
Chn1 T C 2: 73,618,019 D335G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col12a1 A G 9: 79,706,226 probably null Het
Crtac1 T C 19: 42,309,053 probably benign Het
Dhx40 A T 11: 86,784,940 C507* probably null Het
Dok2 A G 14: 70,778,042 D403G probably damaging Het
Eif2b5 A G 16: 20,506,404 T556A possibly damaging Het
Eml6 A T 11: 29,758,981 V1480E probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Glra1 A G 11: 55,536,399 S120P probably damaging Het
Gm2035 T C 12: 87,919,565 D98G probably benign Het
Habp4 T C 13: 64,174,842 S242P probably benign Het
Igkv12-46 A G 6: 69,764,586 I95T probably damaging Het
Itpr2 A G 6: 146,426,459 L92P probably damaging Het
Kcnk2 A G 1: 189,258,736 probably null Het
Krt75 T C 15: 101,572,764 T192A probably benign Het
Lrp1b T A 2: 41,269,187 K1694N Het
Lrrc14 A G 15: 76,714,531 K456E possibly damaging Het
Map1lc3a G T 2: 155,277,209 probably benign Het
Naip5 T A 13: 100,222,233 M832L probably benign Het
Nectin1 A G 9: 43,792,501 T263A probably benign Het
Nnt A T 13: 119,374,750 M330K probably damaging Het
Nrap T C 19: 56,320,251 N1711D possibly damaging Het
Olfm1 A G 2: 28,229,123 N285D possibly damaging Het
Olfr145 A T 9: 37,897,389 probably benign Het
Olfr32 T A 2: 90,138,815 E108V probably damaging Het
Olfr613 T A 7: 103,552,377 S197R possibly damaging Het
Pag1 A G 3: 9,699,422 Y224H probably damaging Het
Pde8a T C 7: 81,308,839 C322R possibly damaging Het
Pde8a A T 7: 81,317,370 T420S probably benign Het
Per2 A C 1: 91,435,703 L365R possibly damaging Het
Pml A G 9: 58,246,973 probably null Het
Ppp1r1a T A 15: 103,537,878 M1L possibly damaging Het
Ppp3r2 G T 4: 49,681,913 C12* probably null Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rsg1 A C 4: 141,220,037 Q243P probably damaging Het
Scyl1 C T 19: 5,760,592 R531Q possibly damaging Het
Skp2 C A 15: 9,139,600 V38F probably damaging Het
Slc27a3 A G 3: 90,389,667 C42R probably damaging Het
Tekt5 A G 16: 10,395,413 F3L probably benign Het
Tmem200c A G 17: 68,840,518 K32R probably benign Het
Tmprss11f T A 5: 86,528,273 R350W probably damaging Het
Tph2 A T 10: 115,179,594 I121N possibly damaging Het
Trim37 A G 11: 87,146,968 D176G possibly damaging Het
Trpc4 A T 3: 54,194,914 I78F probably damaging Het
Ttn T C 2: 76,779,485 K17526E probably damaging Het
Tuba8 A C 6: 121,222,873 Y172S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Urb2 A T 8: 124,028,032 R159S possibly damaging Het
Usp25 T A 16: 77,109,175 C840S probably damaging Het
Vmn1r36 T A 6: 66,715,980 K304* probably null Het
Vmn1r37 C A 6: 66,731,672 T94N probably damaging Het
Vmn2r7 T C 3: 64,707,058 N445S probably damaging Het
Wnk4 G A 11: 101,274,092 G749D probably benign Het
Wscd2 G A 5: 113,551,115 V61I probably benign Het
Zfp85 T A 13: 67,748,979 R325* probably null Het
Other mutations in Itch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Itch APN 2 155213023 missense probably damaging 1.00
IGL00796:Itch APN 2 155209082 missense probably damaging 0.97
IGL01090:Itch APN 2 155206336 missense probably damaging 0.99
IGL01568:Itch APN 2 155212462 splice site probably benign
IGL01844:Itch APN 2 155172547 missense possibly damaging 0.56
IGL01844:Itch APN 2 155172486 missense possibly damaging 0.94
IGL01873:Itch APN 2 155168750 missense possibly damaging 0.68
IGL02129:Itch APN 2 155217988 splice site probably benign
IGL02386:Itch APN 2 155202261 nonsense probably null
IGL02545:Itch APN 2 155172586 splice site probably null
IGL02621:Itch APN 2 155172584 splice site probably null
IGL02708:Itch APN 2 155174044 missense probably benign 0.00
IGL02869:Itch APN 2 155173933 critical splice acceptor site probably null
Abrade UTSW 2 155209078 missense possibly damaging 0.93
dorsolateral UTSW 2 155210558 nonsense probably null
gadfly UTSW 2 155182298 nonsense probably null
hankerin UTSW 2 155210582 critical splice donor site probably null
prurient UTSW 2 155210502 missense probably damaging 1.00
scratch UTSW 2 155172561 missense probably damaging 0.99
R0116:Itch UTSW 2 155217983 splice site probably benign
R0207:Itch UTSW 2 155202257 missense probably benign
R0226:Itch UTSW 2 155199394 missense probably benign 0.01
R0545:Itch UTSW 2 155182298 nonsense probably null
R0689:Itch UTSW 2 155182178 missense possibly damaging 0.82
R1365:Itch UTSW 2 155213031 missense probably benign 0.00
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1436:Itch UTSW 2 155192145 missense probably damaging 0.96
R1639:Itch UTSW 2 155179025 splice site probably null
R1769:Itch UTSW 2 155172561 missense probably damaging 0.99
R1855:Itch UTSW 2 155172454 splice site probably benign
R1865:Itch UTSW 2 155168746 missense probably damaging 0.96
R2008:Itch UTSW 2 155210459 missense possibly damaging 0.91
R2054:Itch UTSW 2 155210576 missense probably damaging 1.00
R2196:Itch UTSW 2 155202221 missense probably benign
R2199:Itch UTSW 2 155202221 missense probably benign
R2252:Itch UTSW 2 155212339 missense probably benign 0.01
R2253:Itch UTSW 2 155212339 missense probably benign 0.01
R2348:Itch UTSW 2 155209078 missense possibly damaging 0.93
R2850:Itch UTSW 2 155202221 missense probably benign
R3021:Itch UTSW 2 155209126 missense possibly damaging 0.74
R4676:Itch UTSW 2 155199435 missense probably benign 0.05
R4716:Itch UTSW 2 155210582 critical splice donor site probably null
R4888:Itch UTSW 2 155217977 splice site probably null
R4970:Itch UTSW 2 155185593 missense possibly damaging 0.50
R6029:Itch UTSW 2 155179089 critical splice donor site probably null
R6122:Itch UTSW 2 155174065 missense probably benign 0.05
R6435:Itch UTSW 2 155209129 missense probably benign 0.01
R6449:Itch UTSW 2 155163395 splice site probably benign
R7069:Itch UTSW 2 155209994 missense probably damaging 1.00
R7083:Itch UTSW 2 155210444 missense probably damaging 1.00
R7409:Itch UTSW 2 155199382 missense probably damaging 0.99
R7689:Itch UTSW 2 155210002 missense probably damaging 0.99
R7689:Itch UTSW 2 155213067 missense probably benign 0.00
R7974:Itch UTSW 2 155192159 missense probably damaging 1.00
R8248:Itch UTSW 2 155206383 critical splice donor site probably null
R8355:Itch UTSW 2 155210582 critical splice donor site probably null
R8428:Itch UTSW 2 155168707 missense probably benign 0.38
R8691:Itch UTSW 2 155210558 nonsense probably null
R8779:Itch UTSW 2 155172520 missense probably benign 0.28
Z1177:Itch UTSW 2 155209059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCCAAGGTCTTAAGTAGTAAC -3'
(R):5'- ATGCCACCCTTTACCATTATTAGAC -3'

Sequencing Primer
(F):5'- GGCTTATTGCTTAAACTCAGAAT -3'
(R):5'- GTACACGCTATGCTCCTGAGTG -3'
Posted On2020-01-23