Mutagenetix > Incidental Mutation

Incidental Mutation 'R8046:Itpr2'

618752

Institutional Source

Beutler Lab

Gene Symbol

Itpr2

Ensembl Gene

ENSMUSG00000030287

Gene Name

inositol 1,4,5-triphosphate receptor 2

Synonyms

Itpr5, Ip3r2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8046 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146108299-146502223 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 146426459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 92 (L92P)

Ref Sequence

ENSEMBL: ENSMUSP00000049584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573] [ENSMUST00000139732]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053273
AA Change: L92P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: L92P

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	173	223	8.9e-6	SMART
MIR	231	287	5.11e-6	SMART
MIR	294	402	3.73e-8	SMART
Pfam:RYDR_ITPR	473	670	1.5e-62	PFAM
low complexity region	882	890	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1346	1.6e-16	PFAM
low complexity region	1773	1785	N/A	INTRINSIC
low complexity region	1897	1908	N/A	INTRINSIC
Pfam:RIH_assoc	1912	2022	4.6e-34	PFAM
low complexity region	2088	2098	N/A	INTRINSIC
transmembrane domain	2228	2250	N/A	INTRINSIC
Pfam:Ion_trans	2260	2552	5.1e-20	PFAM
coiled coil region	2631	2686	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000079573
AA Change: L92P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: L92P

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	198	254	5.11e-6	SMART
MIR	261	369	3.73e-8	SMART
Pfam:RYDR_ITPR	438	644	5.4e-75	PFAM
low complexity region	849	857	N/A	INTRINSIC
Pfam:RYDR_ITPR	1148	1322	7.2e-60	PFAM
low complexity region	1740	1752	N/A	INTRINSIC
Pfam:RIH_assoc	1875	1994	5.8e-35	PFAM
low complexity region	2055	2065	N/A	INTRINSIC
transmembrane domain	2195	2217	N/A	INTRINSIC
transmembrane domain	2230	2249	N/A	INTRINSIC
low complexity region	2268	2279	N/A	INTRINSIC
Pfam:Ion_trans	2281	2507	2.4e-12	PFAM
coiled coil region	2598	2653	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000139732

SMART Domains

Protein: ENSMUSP00000119110
Gene: ENSMUSG00000030287

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
MIR	65	119	1.1e-5	SMART
MIR	126	176	8.9e-6	SMART
MIR	184	240	5.11e-6	SMART
MIR	247	355	3.73e-8	SMART
Pfam:RYDR_ITPR	424	630	3e-76	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	T	5: 76,896,478	D188E	probably benign	Het
Ahcyl2	T	C	6: 29,878,620	L273P	probably damaging	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Angpt1	T	C	15: 42,496,356	T227A	probably benign	Het
Ankle1	C	T	8: 71,408,021	T374M	probably damaging	Het
Arhgap18	T	C	10: 26,887,857	V481A	probably damaging	Het
Astn2	A	T	4: 66,266,350	L170*	probably null	Het
Bms1	T	C	6: 118,408,144	T368A	probably benign	Het
Boll	A	G	1: 55,346,403	I121T	probably damaging	Het
Brca1	A	C	11: 101,525,470	C613G	probably benign	Het
Cdk14	T	A	5: 5,249,159	I65F	possibly damaging	Het
Chn1	T	C	2: 73,618,019	D335G	probably damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Col12a1	A	G	9: 79,706,226		probably null	Het
Crtac1	T	C	19: 42,309,053		probably benign	Het
Dhx40	A	T	11: 86,784,940	C507*	probably null	Het
Dok2	A	G	14: 70,778,042	D403G	probably damaging	Het
Eif2b5	A	G	16: 20,506,404	T556A	possibly damaging	Het
Eml6	A	T	11: 29,758,981	V1480E	probably damaging	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Glra1	A	G	11: 55,536,399	S120P	probably damaging	Het
Gm2035	T	C	12: 87,919,565	D98G	probably benign	Het
Habp4	T	C	13: 64,174,842	S242P	probably benign	Het
Igkv12-46	A	G	6: 69,764,586	I95T	probably damaging	Het
Itch	G	T	2: 155,210,502	G674V	probably damaging	Het
Kcnk2	A	G	1: 189,258,736		probably null	Het
Krt75	T	C	15: 101,572,764	T192A	probably benign	Het
Lrp1b	T	A	2: 41,269,187	K1694N		Het
Lrrc14	A	G	15: 76,714,531	K456E	possibly damaging	Het
Map1lc3a	G	T	2: 155,277,209		probably benign	Het
Naip5	T	A	13: 100,222,233	M832L	probably benign	Het
Nectin1	A	G	9: 43,792,501	T263A	probably benign	Het
Nnt	A	T	13: 119,374,750	M330K	probably damaging	Het
Nrap	T	C	19: 56,320,251	N1711D	possibly damaging	Het
Olfm1	A	G	2: 28,229,123	N285D	possibly damaging	Het
Olfr145	A	T	9: 37,897,389		probably benign	Het
Olfr32	T	A	2: 90,138,815	E108V	probably damaging	Het
Olfr613	T	A	7: 103,552,377	S197R	possibly damaging	Het
Pag1	A	G	3: 9,699,422	Y224H	probably damaging	Het
Pde8a	T	C	7: 81,308,839	C322R	possibly damaging	Het
Pde8a	A	T	7: 81,317,370	T420S	probably benign	Het
Per2	A	C	1: 91,435,703	L365R	possibly damaging	Het
Pml	A	G	9: 58,246,973		probably null	Het
Ppp1r1a	T	A	15: 103,537,878	M1L	possibly damaging	Het
Ppp3r2	G	T	4: 49,681,913	C12*	probably null	Het
Rbm20	C	A	19: 53,817,971	A494D	probably benign	Het
Rsg1	A	C	4: 141,220,037	Q243P	probably damaging	Het
Scyl1	C	T	19: 5,760,592	R531Q	possibly damaging	Het
Skp2	C	A	15: 9,139,600	V38F	probably damaging	Het
Slc27a3	A	G	3: 90,389,667	C42R	probably damaging	Het
Tekt5	A	G	16: 10,395,413	F3L	probably benign	Het
Tmem200c	A	G	17: 68,840,518	K32R	probably benign	Het
Tmprss11f	T	A	5: 86,528,273	R350W	probably damaging	Het
Tph2	A	T	10: 115,179,594	I121N	possibly damaging	Het
Trim37	A	G	11: 87,146,968	D176G	possibly damaging	Het
Trpc4	A	T	3: 54,194,914	I78F	probably damaging	Het
Ttn	T	C	2: 76,779,485	K17526E	probably damaging	Het
Tuba8	A	C	6: 121,222,873	Y172S	probably damaging	Het
Tubg1	G	T	11: 101,124,028	A199S	probably benign	Het
Urb2	A	T	8: 124,028,032	R159S	possibly damaging	Het
Usp25	T	A	16: 77,109,175	C840S	probably damaging	Het
Vmn1r36	T	A	6: 66,715,980	K304*	probably null	Het
Vmn1r37	C	A	6: 66,731,672	T94N	probably damaging	Het
Vmn2r7	T	C	3: 64,707,058	N445S	probably damaging	Het
Wnk4	G	A	11: 101,274,092	G749D	probably benign	Het
Wscd2	G	A	5: 113,551,115	V61I	probably benign	Het
Zfp85	T	A	13: 67,748,979	R325*	probably null	Het

Other mutations in Itpr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Itpr2	APN	6	146397012	missense	probably damaging	0.99
IGL00163:Itpr2	APN	6	146390836	missense	possibly damaging	0.88
IGL00229:Itpr2	APN	6	146144185	missense	probably damaging	1.00
IGL00712:Itpr2	APN	6	146232436	missense	possibly damaging	0.63
IGL00952:Itpr2	APN	6	146158961	missense	probably damaging	1.00
IGL00983:Itpr2	APN	6	146310981	splice site	probably benign
IGL01012:Itpr2	APN	6	146345161	missense	probably damaging	1.00
IGL01289:Itpr2	APN	6	146112535	nonsense	probably null
IGL01411:Itpr2	APN	6	146376062	critical splice donor site	probably null
IGL01557:Itpr2	APN	6	146158976	missense	probably damaging	0.99
IGL01669:Itpr2	APN	6	146180229	missense	probably damaging	1.00
IGL01809:Itpr2	APN	6	146227581	missense	probably damaging	1.00
IGL01814:Itpr2	APN	6	146232546	missense	probably benign	0.02
IGL02198:Itpr2	APN	6	146323227	missense	probably damaging	1.00
IGL02218:Itpr2	APN	6	146240262	splice site	probably benign
IGL02332:Itpr2	APN	6	146426542	missense	probably damaging	1.00
IGL02425:Itpr2	APN	6	146391321	missense	probably damaging	0.99
IGL02432:Itpr2	APN	6	146325173	missense	probably benign	0.05
IGL02726:Itpr2	APN	6	146375921	missense	probably benign	0.18
IGL02851:Itpr2	APN	6	146385979	missense	probably damaging	0.99
IGL02933:Itpr2	APN	6	146312904	missense	probably benign
IGL03015:Itpr2	APN	6	146375937	missense	probably benign
IGL03067:Itpr2	APN	6	146325182	missense	probably damaging	1.00
IGL03093:Itpr2	APN	6	146379510	missense	probably damaging	1.00
IGL03214:Itpr2	APN	6	146180244	missense	probably benign	0.02
IGL03275:Itpr2	APN	6	146158877	splice site	probably benign
IGL03332:Itpr2	APN	6	146144149	missense	probably damaging	0.98
IGL03352:Itpr2	APN	6	146157104	missense	probably damaging	1.00
IGL03377:Itpr2	APN	6	146329715	missense	probably damaging	0.96
IGL03377:Itpr2	APN	6	146329758	missense	probably benign
dollar_short	UTSW	6	146397019	nonsense	probably null
enfermos	UTSW	6	146234006	missense	probably damaging	0.98
Hopla	UTSW	6	146194598	missense	probably damaging	0.98
P0029:Itpr2	UTSW	6	146379489	missense	probably damaging	1.00
PIT4431001:Itpr2	UTSW	6	146354720	missense	probably benign
PIT4453001:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
PIT4504001:Itpr2	UTSW	6	146229871	missense	probably damaging	0.99
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0088:Itpr2	UTSW	6	146241185	missense	probably benign
R0089:Itpr2	UTSW	6	146350022	critical splice donor site	probably null
R0114:Itpr2	UTSW	6	146312879	missense	probably damaging	1.00
R0125:Itpr2	UTSW	6	146240453	missense	probably benign	0.00
R0144:Itpr2	UTSW	6	146327155	missense	probably damaging	0.98
R0180:Itpr2	UTSW	6	146501909	start gained	probably benign
R0211:Itpr2	UTSW	6	146194613	missense	probably benign	0.17
R0305:Itpr2	UTSW	6	146311103	missense	possibly damaging	0.63
R0367:Itpr2	UTSW	6	146234008	missense	probably damaging	1.00
R0374:Itpr2	UTSW	6	146359392	missense	probably benign	0.00
R0391:Itpr2	UTSW	6	146229773	missense	probably damaging	1.00
R0450:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0464:Itpr2	UTSW	6	146375889	missense	probably damaging	1.00
R0510:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0532:Itpr2	UTSW	6	146112400	missense	probably damaging	1.00
R0625:Itpr2	UTSW	6	146166651	missense	probably benign
R0633:Itpr2	UTSW	6	146374456	missense	probably damaging	1.00
R0636:Itpr2	UTSW	6	146171412	missense	probably damaging	1.00
R1086:Itpr2	UTSW	6	146350045	missense	probably damaging	1.00
R1352:Itpr2	UTSW	6	146111742	missense	probably damaging	1.00
R1631:Itpr2	UTSW	6	146180290	missense	probably damaging	1.00
R1655:Itpr2	UTSW	6	146376148	missense	probably damaging	1.00
R1767:Itpr2	UTSW	6	146350068	missense	possibly damaging	0.91
R1779:Itpr2	UTSW	6	146158901	nonsense	probably null
R1796:Itpr2	UTSW	6	146296673	missense	probably benign
R1815:Itpr2	UTSW	6	146359416	missense	probably benign	0.08
R1827:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1828:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1884:Itpr2	UTSW	6	146385971	missense	probably benign	0.16
R1902:Itpr2	UTSW	6	146229703	missense	probably damaging	1.00
R1931:Itpr2	UTSW	6	146240354	missense	probably benign	0.41
R1964:Itpr2	UTSW	6	146111693	missense	probably damaging	1.00
R2010:Itpr2	UTSW	6	146227524	splice site	probably null
R2168:Itpr2	UTSW	6	146111678	missense	probably benign	0.05
R2179:Itpr2	UTSW	6	146375966	missense	probably benign
R2290:Itpr2	UTSW	6	146422828	missense	probably damaging	1.00
R2874:Itpr2	UTSW	6	146426498	missense	possibly damaging	0.73
R2888:Itpr2	UTSW	6	146171293	missense	probably damaging	1.00
R2897:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2897:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R2898:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2898:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R3024:Itpr2	UTSW	6	146180310	missense	probably benign	0.35
R3104:Itpr2	UTSW	6	146312837	critical splice donor site	probably null
R3607:Itpr2	UTSW	6	146227601	missense	probably damaging	0.98
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3733:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3792:Itpr2	UTSW	6	146415354	missense	probably damaging	1.00
R3806:Itpr2	UTSW	6	146232291	splice site	probably null
R3821:Itpr2	UTSW	6	146417726	missense	probably damaging	1.00
R3929:Itpr2	UTSW	6	146374359	splice site	probably null
R3958:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3959:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3960:Itpr2	UTSW	6	146229764	missense	probably damaging	1.00
R3960:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4074:Itpr2	UTSW	6	146373244	splice site	probably null
R4085:Itpr2	UTSW	6	146144248	missense	probably damaging	1.00
R4114:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4115:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4588:Itpr2	UTSW	6	146241196	missense	probably benign	0.33
R4663:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4673:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4684:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4686:Itpr2	UTSW	6	146229775	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146396958	missense	probably damaging	1.00
R4729:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4732:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4733:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4801:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4802:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4877:Itpr2	UTSW	6	146325205	missense	probably damaging	1.00
R4970:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R4986:Itpr2	UTSW	6	146240342	missense	probably damaging	0.96
R5112:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R5200:Itpr2	UTSW	6	146144107	critical splice donor site	probably null
R5224:Itpr2	UTSW	6	146166651	missense	probably benign
R5243:Itpr2	UTSW	6	146187546	missense	probably damaging	1.00
R5348:Itpr2	UTSW	6	146476693	missense	possibly damaging	0.78
R5393:Itpr2	UTSW	6	146376155	nonsense	probably null
R5552:Itpr2	UTSW	6	146294080	missense	probably benign
R5579:Itpr2	UTSW	6	146173366	nonsense	probably null
R5744:Itpr2	UTSW	6	146376151	missense	probably damaging	1.00
R5825:Itpr2	UTSW	6	146144149	missense	probably damaging	0.98
R5910:Itpr2	UTSW	6	146329571	missense	probably benign	0.10
R5911:Itpr2	UTSW	6	146312943	missense	probably benign	0.42
R6044:Itpr2	UTSW	6	146396951	missense	probably null	0.98
R6072:Itpr2	UTSW	6	146347111	missense	probably damaging	0.98
R6191:Itpr2	UTSW	6	146328335	missense	probably benign	0.01
R6483:Itpr2	UTSW	6	146112477	missense	possibly damaging	0.52
R6511:Itpr2	UTSW	6	146329727	missense	probably damaging	1.00
R6524:Itpr2	UTSW	6	146345211	missense	probably benign	0.01
R6561:Itpr2	UTSW	6	146234006	missense	probably damaging	0.98
R6594:Itpr2	UTSW	6	146190480	missense	possibly damaging	0.71
R6603:Itpr2	UTSW	6	146347171	missense	probably damaging	0.98
R6736:Itpr2	UTSW	6	146325170	missense	probably damaging	1.00
R6783:Itpr2	UTSW	6	146385873	critical splice donor site	probably null
R6831:Itpr2	UTSW	6	146112429	missense	probably damaging	1.00
R6857:Itpr2	UTSW	6	146397019	nonsense	probably null
R7103:Itpr2	UTSW	6	146325074	missense	probably damaging	1.00
R7111:Itpr2	UTSW	6	146325056	missense	probably damaging	1.00
R7126:Itpr2	UTSW	6	146357796	nonsense	probably null
R7165:Itpr2	UTSW	6	146294091	missense	probably damaging	1.00
R7184:Itpr2	UTSW	6	146311087	missense	possibly damaging	0.79
R7249:Itpr2	UTSW	6	146311052	missense	probably damaging	1.00
R7292:Itpr2	UTSW	6	146158949	missense	possibly damaging	0.95
R7342:Itpr2	UTSW	6	146327187	missense	probably damaging	0.98
R7392:Itpr2	UTSW	6	146359340	missense	possibly damaging	0.95
R7414:Itpr2	UTSW	6	146373208	missense	probably benign	0.06
R7448:Itpr2	UTSW	6	146329508	missense	probably damaging	1.00
R7492:Itpr2	UTSW	6	146390938	missense	probably damaging	1.00
R7515:Itpr2	UTSW	6	146327110	missense	probably damaging	1.00
R7529:Itpr2	UTSW	6	146194598	missense	probably damaging	0.98
R7558:Itpr2	UTSW	6	146390865	missense	probably damaging	1.00
R7650:Itpr2	UTSW	6	146233994	missense	probably benign	0.36
R7678:Itpr2	UTSW	6	146187550	missense	probably benign	0.00
R7790:Itpr2	UTSW	6	146224776	missense	probably damaging	1.00
R7798:Itpr2	UTSW	6	146386015	missense	probably benign	0.06
R7831:Itpr2	UTSW	6	146291584	missense	probably benign	0.04
R8023:Itpr2	UTSW	6	146187490	missense	probably damaging	0.97
R8236:Itpr2	UTSW	6	146390783	critical splice donor site	probably null
R8241:Itpr2	UTSW	6	146418515	missense	possibly damaging	0.90
R8245:Itpr2	UTSW	6	146373106	missense	probably damaging	0.98
R8324:Itpr2	UTSW	6	146328398	missense	probably damaging	0.97
R8339:Itpr2	UTSW	6	146312898	missense	probably benign	0.19
R8458:Itpr2	UTSW	6	146233966	missense	possibly damaging	0.62
R8506:Itpr2	UTSW	6	146418416	critical splice donor site	probably null
R8529:Itpr2	UTSW	6	146329553	missense	probably damaging	1.00
R8672:Itpr2	UTSW	6	146374518	missense	probably damaging	1.00
R8755:Itpr2	UTSW	6	146232428	missense	probably benign
R8816:Itpr2	UTSW	6	146241212	missense	probably damaging	0.98
R9160:Itpr2	UTSW	6	146374601	missense	probably damaging	1.00
R9273:Itpr2	UTSW	6	146325031	missense	probably damaging	1.00
R9284:Itpr2	UTSW	6	146354676	missense	probably benign	0.01
R9322:Itpr2	UTSW	6	146325089	missense	probably benign	0.19
R9357:Itpr2	UTSW	6	146359316	missense	probably damaging	1.00
R9424:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
R9438:Itpr2	UTSW	6	146166668	missense	probably benign
R9576:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
V8831:Itpr2	UTSW	6	146385882	missense	probably damaging	1.00
X0054:Itpr2	UTSW	6	146323236	missense	probably damaging	1.00
X0063:Itpr2	UTSW	6	146180353	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCAAGTTCATACTCAGCC -3'
(R):5'- TTGCAAAGGGTCTAGAGAACAC -3'

Sequencing Primer
(F):5'- GGCAAGTTCATACTCAGCCAAACC -3'
(R):5'- GAACACTGGGAGCCCTAGTTATC -3'

Posted On

2020-01-23