Incidental Mutation 'R8046:Olfr145'
ID618758
Institutional Source Beutler Lab
Gene Symbol Olfr145
Ensembl Gene ENSMUSG00000066748
Gene Nameolfactory receptor 145
SynonymsK21, MOR161-6, GA_x6K02T2PVTD-31578734-31579666
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R8046 (G1)
Quality Score222.009
Status Validated
Chromosome9
Chromosomal Location37896724-37903519 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 37897389 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086062] [ENSMUST00000213688]
Predicted Effect probably benign
Transcript: ENSMUST00000086062
SMART Domains Protein: ENSMUSP00000083229
Gene: ENSMUSG00000066748

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4e-51 PFAM
Pfam:7tm_1 40 289 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213688
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G T 5: 76,896,478 D188E probably benign Het
Ahcyl2 T C 6: 29,878,620 L273P probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Angpt1 T C 15: 42,496,356 T227A probably benign Het
Ankle1 C T 8: 71,408,021 T374M probably damaging Het
Arhgap18 T C 10: 26,887,857 V481A probably damaging Het
Astn2 A T 4: 66,266,350 L170* probably null Het
Bms1 T C 6: 118,408,144 T368A probably benign Het
Boll A G 1: 55,346,403 I121T probably damaging Het
Brca1 A C 11: 101,525,470 C613G probably benign Het
Cdk14 T A 5: 5,249,159 I65F possibly damaging Het
Chn1 T C 2: 73,618,019 D335G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col12a1 A G 9: 79,706,226 probably null Het
Crtac1 T C 19: 42,309,053 probably benign Het
Dhx40 A T 11: 86,784,940 C507* probably null Het
Dok2 A G 14: 70,778,042 D403G probably damaging Het
Eif2b5 A G 16: 20,506,404 T556A possibly damaging Het
Eml6 A T 11: 29,758,981 V1480E probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Glra1 A G 11: 55,536,399 S120P probably damaging Het
Gm2035 T C 12: 87,919,565 D98G probably benign Het
Habp4 T C 13: 64,174,842 S242P probably benign Het
Igkv12-46 A G 6: 69,764,586 I95T probably damaging Het
Itch G T 2: 155,210,502 G674V probably damaging Het
Itpr2 A G 6: 146,426,459 L92P probably damaging Het
Kcnk2 A G 1: 189,258,736 probably null Het
Krt75 T C 15: 101,572,764 T192A probably benign Het
Lrp1b T A 2: 41,269,187 K1694N Het
Lrrc14 A G 15: 76,714,531 K456E possibly damaging Het
Map1lc3a G T 2: 155,277,209 probably benign Het
Naip5 T A 13: 100,222,233 M832L probably benign Het
Nectin1 A G 9: 43,792,501 T263A probably benign Het
Nnt A T 13: 119,374,750 M330K probably damaging Het
Nrap T C 19: 56,320,251 N1711D possibly damaging Het
Olfm1 A G 2: 28,229,123 N285D possibly damaging Het
Olfr32 T A 2: 90,138,815 E108V probably damaging Het
Olfr613 T A 7: 103,552,377 S197R possibly damaging Het
Pag1 A G 3: 9,699,422 Y224H probably damaging Het
Pde8a T C 7: 81,308,839 C322R possibly damaging Het
Pde8a A T 7: 81,317,370 T420S probably benign Het
Per2 A C 1: 91,435,703 L365R possibly damaging Het
Pml A G 9: 58,246,973 probably null Het
Ppp1r1a T A 15: 103,537,878 M1L possibly damaging Het
Ppp3r2 G T 4: 49,681,913 C12* probably null Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rsg1 A C 4: 141,220,037 Q243P probably damaging Het
Scyl1 C T 19: 5,760,592 R531Q possibly damaging Het
Skp2 C A 15: 9,139,600 V38F probably damaging Het
Slc27a3 A G 3: 90,389,667 C42R probably damaging Het
Tekt5 A G 16: 10,395,413 F3L probably benign Het
Tmem200c A G 17: 68,840,518 K32R probably benign Het
Tmprss11f T A 5: 86,528,273 R350W probably damaging Het
Tph2 A T 10: 115,179,594 I121N possibly damaging Het
Trim37 A G 11: 87,146,968 D176G possibly damaging Het
Trpc4 A T 3: 54,194,914 I78F probably damaging Het
Ttn T C 2: 76,779,485 K17526E probably damaging Het
Tuba8 A C 6: 121,222,873 Y172S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Urb2 A T 8: 124,028,032 R159S possibly damaging Het
Usp25 T A 16: 77,109,175 C840S probably damaging Het
Vmn1r36 T A 6: 66,715,980 K304* probably null Het
Vmn1r37 C A 6: 66,731,672 T94N probably damaging Het
Vmn2r7 T C 3: 64,707,058 N445S probably damaging Het
Wnk4 G A 11: 101,274,092 G749D probably benign Het
Wscd2 G A 5: 113,551,115 V61I probably benign Het
Zfp85 T A 13: 67,748,979 R325* probably null Het
Other mutations in Olfr145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Olfr145 APN 9 37898063 missense probably benign 0.13
IGL01586:Olfr145 APN 9 37897976 missense possibly damaging 0.73
IGL02185:Olfr145 APN 9 37898235 missense probably damaging 1.00
IGL02895:Olfr145 APN 9 37897982 missense probably benign 0.01
IGL02956:Olfr145 APN 9 37898108 missense probably damaging 1.00
R0391:Olfr145 UTSW 9 37897842 missense probably benign 0.31
R0513:Olfr145 UTSW 9 37898055 missense probably damaging 1.00
R4600:Olfr145 UTSW 9 37898326 missense probably benign
R4610:Olfr145 UTSW 9 37898326 missense probably benign
R4611:Olfr145 UTSW 9 37898326 missense probably benign
R4982:Olfr145 UTSW 9 37897515 missense probably damaging 1.00
R5574:Olfr145 UTSW 9 37897581 missense probably damaging 1.00
R5608:Olfr145 UTSW 9 37897782 missense probably damaging 0.98
R5688:Olfr145 UTSW 9 37898063 missense possibly damaging 0.91
R5906:Olfr145 UTSW 9 37897878 missense probably damaging 1.00
R6286:Olfr145 UTSW 9 37897778 missense probably damaging 0.99
R7138:Olfr145 UTSW 9 37898064 missense probably damaging 0.99
R7145:Olfr145 UTSW 9 37897563 missense probably benign 0.01
R7993:Olfr145 UTSW 9 37897337 intron probably benign
R8185:Olfr145 UTSW 9 37898235 missense probably damaging 1.00
X0012:Olfr145 UTSW 9 37898328 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTGAGAGTCCCCTCACTG -3'
(R):5'- AGTTCAGTCCAATCAGGGTG -3'

Sequencing Primer
(F):5'- TAACCTAAAGGACCCTTGTGTC -3'
(R):5'- TTCAGTCCAATCAGGGTGATCAAG -3'
Posted On2020-01-23