Incidental Mutation 'R8046:Nectin1'
ID618759
Institutional Source Beutler Lab
Gene Symbol Nectin1
Ensembl Gene ENSMUSG00000032012
Gene Namenectin cell adhesion molecule 1
SynonymsHveC, Pvrl1, HIgR, nectin-1, PRR, Cd111, PRR1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R8046 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location43743984-43807461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43792501 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 263 (T263A)
Ref Sequence ENSEMBL: ENSMUSP00000034510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034510] [ENSMUST00000216893]
PDB Structure
Solution structure of the third Immunoglobulin-like domain of nectin-1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000034510
AA Change: T263A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034510
Gene: ENSMUSG00000032012
AA Change: T263A

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
IG 36 143 8.51e-7 SMART
Pfam:C2-set_2 148 237 8.5e-21 PFAM
IG 254 334 1.28e-1 SMART
transmembrane domain 355 377 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216893
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice exhibit eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses, and open eyelids at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G T 5: 76,896,478 D188E probably benign Het
Ahcyl2 T C 6: 29,878,620 L273P probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Angpt1 T C 15: 42,496,356 T227A probably benign Het
Ankle1 C T 8: 71,408,021 T374M probably damaging Het
Arhgap18 T C 10: 26,887,857 V481A probably damaging Het
Astn2 A T 4: 66,266,350 L170* probably null Het
Bms1 T C 6: 118,408,144 T368A probably benign Het
Boll A G 1: 55,346,403 I121T probably damaging Het
Brca1 A C 11: 101,525,470 C613G probably benign Het
Cdk14 T A 5: 5,249,159 I65F possibly damaging Het
Chn1 T C 2: 73,618,019 D335G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col12a1 A G 9: 79,706,226 probably null Het
Dhx40 A T 11: 86,784,940 C507* probably null Het
Dok2 A G 14: 70,778,042 D403G probably damaging Het
Eif2b5 A G 16: 20,506,404 T556A possibly damaging Het
Eml6 A T 11: 29,758,981 V1480E probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Glra1 A G 11: 55,536,399 S120P probably damaging Het
Gm2035 T C 12: 87,919,565 D98G probably benign Het
Habp4 T C 13: 64,174,842 S242P probably benign Het
Igkv12-46 A G 6: 69,764,586 I95T probably damaging Het
Itch G T 2: 155,210,502 G674V probably damaging Het
Itpr2 A G 6: 146,426,459 L92P probably damaging Het
Kcnk2 A G 1: 189,258,736 probably null Het
Krt75 T C 15: 101,572,764 T192A probably benign Het
Lrp1b T A 2: 41,269,187 K1694N Het
Lrrc14 A G 15: 76,714,531 K456E possibly damaging Het
Naip5 T A 13: 100,222,233 M832L probably benign Het
Nnt A T 13: 119,374,750 M330K probably damaging Het
Nrap T C 19: 56,320,251 N1711D possibly damaging Het
Olfm1 A G 2: 28,229,123 N285D possibly damaging Het
Olfr145 A T 9: 37,897,389 probably benign Het
Olfr32 T A 2: 90,138,815 E108V probably damaging Het
Olfr613 T A 7: 103,552,377 S197R possibly damaging Het
Pag1 A G 3: 9,699,422 Y224H probably damaging Het
Pde8a T C 7: 81,308,839 C322R possibly damaging Het
Pde8a A T 7: 81,317,370 T420S probably benign Het
Per2 A C 1: 91,435,703 L365R possibly damaging Het
Pml A G 9: 58,246,973 probably null Het
Ppp1r1a T A 15: 103,537,878 M1L possibly damaging Het
Ppp3r2 G T 4: 49,681,913 C12* probably null Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rsg1 A C 4: 141,220,037 Q243P probably damaging Het
Scyl1 C T 19: 5,760,592 R531Q possibly damaging Het
Skp2 C A 15: 9,139,600 V38F probably damaging Het
Slc27a3 A G 3: 90,389,667 C42R probably damaging Het
Tekt5 A G 16: 10,395,413 F3L probably benign Het
Tmem200c A G 17: 68,840,518 K32R probably benign Het
Tmprss11f T A 5: 86,528,273 R350W probably damaging Het
Tph2 A T 10: 115,179,594 I121N possibly damaging Het
Trim37 A G 11: 87,146,968 D176G possibly damaging Het
Trpc4 A T 3: 54,194,914 I78F probably damaging Het
Ttn T C 2: 76,779,485 K17526E probably damaging Het
Tuba8 A C 6: 121,222,873 Y172S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Urb2 A T 8: 124,028,032 R159S possibly damaging Het
Usp25 T A 16: 77,109,175 C840S probably damaging Het
Vmn1r36 T A 6: 66,715,980 K304* probably null Het
Vmn1r37 C A 6: 66,731,672 T94N probably damaging Het
Vmn2r7 T C 3: 64,707,058 N445S probably damaging Het
Wnk4 G A 11: 101,274,092 G749D probably benign Het
Wscd2 G A 5: 113,551,115 V61I probably benign Het
Zfp85 T A 13: 67,748,979 R325* probably null Het
Other mutations in Nectin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Nectin1 APN 9 43791258 nonsense probably null
IGL01939:Nectin1 APN 9 43792574 unclassified probably benign
IGL01978:Nectin1 APN 9 43792147 missense probably damaging 0.99
IGL02795:Nectin1 APN 9 43803552 missense probably benign
K3955:Nectin1 UTSW 9 43792078 missense probably damaging 1.00
R0563:Nectin1 UTSW 9 43791045 missense probably benign
R1439:Nectin1 UTSW 9 43792099 missense possibly damaging 0.78
R1822:Nectin1 UTSW 9 43791077 nonsense probably null
R4356:Nectin1 UTSW 9 43792505 missense probably benign 0.22
R5153:Nectin1 UTSW 9 43803498 missense probably damaging 0.99
R5516:Nectin1 UTSW 9 43803793 missense probably benign 0.03
R5864:Nectin1 UTSW 9 43791310 missense probably damaging 1.00
R6903:Nectin1 UTSW 9 43791882 missense possibly damaging 0.95
R7791:Nectin1 UTSW 9 43792039 missense probably benign 0.08
R7878:Nectin1 UTSW 9 43803901 missense probably benign 0.10
R7961:Nectin1 UTSW 9 43803901 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AATGCTGCAATCTCCCTGTC -3'
(R):5'- TGGCGGTCTCTTAAACCGAC -3'

Sequencing Primer
(F):5'- CTGAGGTTCTGTGATAGATACCTAC -3'
(R):5'- GGTCTCTTAAACCGACCCCGAC -3'
Posted On2020-01-23