Mutagenetix > Incidental Mutations

Incidental Mutation 'R8046:Tph2'

618764

Institutional Source

Beutler Lab

Gene Symbol

Tph2

Ensembl Gene

ENSMUSG00000006764

Gene Name

tryptophan hydroxylase 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R8046 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115078641-115185022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 115179594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 121 (I121N)

Ref Sequence

ENSEMBL: ENSMUSP00000006949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006949]

AlphaFold

Q8CGV2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006949
AA Change: I121N

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: I121N

Domain	Start	End	E-Value	Type
low complexity region	94	102	N/A	INTRINSIC
Pfam:Biopterin_H	150	480	3.6e-177	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	T	5: 76,896,478	D188E	probably benign	Het
Ahcyl2	T	C	6: 29,878,620	L273P	probably damaging	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Angpt1	T	C	15: 42,496,356	T227A	probably benign	Het
Ankle1	C	T	8: 71,408,021	T374M	probably damaging	Het
Arhgap18	T	C	10: 26,887,857	V481A	probably damaging	Het
Astn2	A	T	4: 66,266,350	L170*	probably null	Het
Bms1	T	C	6: 118,408,144	T368A	probably benign	Het
Boll	A	G	1: 55,346,403	I121T	probably damaging	Het
Brca1	A	C	11: 101,525,470	C613G	probably benign	Het
Cdk14	T	A	5: 5,249,159	I65F	possibly damaging	Het
Chn1	T	C	2: 73,618,019	D335G	probably damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Col12a1	A	G	9: 79,706,226		probably null	Het
Crtac1	T	C	19: 42,309,053		probably benign	Het
Dhx40	A	T	11: 86,784,940	C507*	probably null	Het
Dok2	A	G	14: 70,778,042	D403G	probably damaging	Het
Eif2b5	A	G	16: 20,506,404	T556A	possibly damaging	Het
Eml6	A	T	11: 29,758,981	V1480E	probably damaging	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Glra1	A	G	11: 55,536,399	S120P	probably damaging	Het
Gm2035	T	C	12: 87,919,565	D98G	probably benign	Het
Habp4	T	C	13: 64,174,842	S242P	probably benign	Het
Igkv12-46	A	G	6: 69,764,586	I95T	probably damaging	Het
Itch	G	T	2: 155,210,502	G674V	probably damaging	Het
Itpr2	A	G	6: 146,426,459	L92P	probably damaging	Het
Kcnk2	A	G	1: 189,258,736		probably null	Het
Krt75	T	C	15: 101,572,764	T192A	probably benign	Het
Lrp1b	T	A	2: 41,269,187	K1694N		Het
Lrrc14	A	G	15: 76,714,531	K456E	possibly damaging	Het
Map1lc3a	G	T	2: 155,277,209		probably benign	Het
Naip5	T	A	13: 100,222,233	M832L	probably benign	Het
Nectin1	A	G	9: 43,792,501	T263A	probably benign	Het
Nnt	A	T	13: 119,374,750	M330K	probably damaging	Het
Nrap	T	C	19: 56,320,251	N1711D	possibly damaging	Het
Olfm1	A	G	2: 28,229,123	N285D	possibly damaging	Het
Olfr145	A	T	9: 37,897,389		probably benign	Het
Olfr32	T	A	2: 90,138,815	E108V	probably damaging	Het
Olfr613	T	A	7: 103,552,377	S197R	possibly damaging	Het
Pag1	A	G	3: 9,699,422	Y224H	probably damaging	Het
Pde8a	T	C	7: 81,308,839	C322R	possibly damaging	Het
Pde8a	A	T	7: 81,317,370	T420S	probably benign	Het
Per2	A	C	1: 91,435,703	L365R	possibly damaging	Het
Pml	A	G	9: 58,246,973		probably null	Het
Ppp1r1a	T	A	15: 103,537,878	M1L	possibly damaging	Het
Ppp3r2	G	T	4: 49,681,913	C12*	probably null	Het
Rbm20	C	A	19: 53,817,971	A494D	probably benign	Het
Rsg1	A	C	4: 141,220,037	Q243P	probably damaging	Het
Scyl1	C	T	19: 5,760,592	R531Q	possibly damaging	Het
Skp2	C	A	15: 9,139,600	V38F	probably damaging	Het
Slc27a3	A	G	3: 90,389,667	C42R	probably damaging	Het
Tekt5	A	G	16: 10,395,413	F3L	probably benign	Het
Tmem200c	A	G	17: 68,840,518	K32R	probably benign	Het
Tmprss11f	T	A	5: 86,528,273	R350W	probably damaging	Het
Trim37	A	G	11: 87,146,968	D176G	possibly damaging	Het
Trpc4	A	T	3: 54,194,914	I78F	probably damaging	Het
Ttn	T	C	2: 76,779,485	K17526E	probably damaging	Het
Tuba8	A	C	6: 121,222,873	Y172S	probably damaging	Het
Tubg1	G	T	11: 101,124,028	A199S	probably benign	Het
Urb2	A	T	8: 124,028,032	R159S	possibly damaging	Het
Usp25	T	A	16: 77,109,175	C840S	probably damaging	Het
Vmn1r36	T	A	6: 66,715,980	K304*	probably null	Het
Vmn1r37	C	A	6: 66,731,672	T94N	probably damaging	Het
Vmn2r7	T	C	3: 64,707,058	N445S	probably damaging	Het
Wnk4	G	A	11: 101,274,092	G749D	probably benign	Het
Wscd2	G	A	5: 113,551,115	V61I	probably benign	Het
Zfp85	T	A	13: 67,748,979	R325*	probably null	Het

Other mutations in Tph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Tph2	APN	10	115079759	nonsense	probably null
IGL01989:Tph2	APN	10	115146016	missense	probably benign	0.22
IGL02363:Tph2	APN	10	115079981	missense	probably benign	0.01
IGL02667:Tph2	APN	10	115080045	missense	probably benign	0.43
R0390:Tph2	UTSW	10	115174109	missense	probably damaging	1.00
R0400:Tph2	UTSW	10	115080120	splice site	probably benign
R0570:Tph2	UTSW	10	115174134	splice site	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1654:Tph2	UTSW	10	115184807	missense	probably benign
R3705:Tph2	UTSW	10	115119893	nonsense	probably null
R3710:Tph2	UTSW	10	115174058	missense	probably benign	0.42
R3777:Tph2	UTSW	10	115080005	missense	probably benign
R4794:Tph2	UTSW	10	115182770	missense	possibly damaging	0.84
R5015:Tph2	UTSW	10	115079716	missense	probably benign	0.01
R5068:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5069:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5070:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5422:Tph2	UTSW	10	115079764	missense	possibly damaging	0.94
R5487:Tph2	UTSW	10	115119874	missense	probably damaging	1.00
R5604:Tph2	UTSW	10	115090709	missense	probably damaging	1.00
R5692:Tph2	UTSW	10	115184827	missense	probably damaging	0.97
R6368:Tph2	UTSW	10	115179326	missense	probably damaging	1.00
R6802:Tph2	UTSW	10	115184873	missense	probably damaging	1.00
R6823:Tph2	UTSW	10	115174106	missense	probably benign	0.02
R7371:Tph2	UTSW	10	115151111	missense	probably damaging	1.00
R7724:Tph2	UTSW	10	115079822	missense	probably benign
R7863:Tph2	UTSW	10	115080001	missense	probably damaging	1.00
R8738:Tph2	UTSW	10	115179709	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGAGATCTTCCGAGGGAAC -3'
(R):5'- TTTGATAGCTGCACAAGGCC -3'

Sequencing Primer
(F):5'- TCCTCGAGATCTGCAGGTAACAG -3'
(R):5'- ACAAGGCCAGCATTCCGTTTG -3'

Posted On

2020-01-23