Incidental Mutation 'R8046:Brca1'
ID618771
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8046 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101525470 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 613 (C613G)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
Predicted Effect probably benign
Transcript: ENSMUST00000017290
AA Change: C613G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: C613G

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G T 5: 76,896,478 D188E probably benign Het
Ahcyl2 T C 6: 29,878,620 L273P probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Angpt1 T C 15: 42,496,356 T227A probably benign Het
Ankle1 C T 8: 71,408,021 T374M probably damaging Het
Arhgap18 T C 10: 26,887,857 V481A probably damaging Het
Astn2 A T 4: 66,266,350 L170* probably null Het
Bms1 T C 6: 118,408,144 T368A probably benign Het
Boll A G 1: 55,346,403 I121T probably damaging Het
Cdk14 T A 5: 5,249,159 I65F possibly damaging Het
Chn1 T C 2: 73,618,019 D335G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col12a1 A G 9: 79,706,226 probably null Het
Dhx40 A T 11: 86,784,940 C507* probably null Het
Dok2 A G 14: 70,778,042 D403G probably damaging Het
Eif2b5 A G 16: 20,506,404 T556A possibly damaging Het
Eml6 A T 11: 29,758,981 V1480E probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Glra1 A G 11: 55,536,399 S120P probably damaging Het
Gm2035 T C 12: 87,919,565 D98G probably benign Het
Habp4 T C 13: 64,174,842 S242P probably benign Het
Igkv12-46 A G 6: 69,764,586 I95T probably damaging Het
Itch G T 2: 155,210,502 G674V probably damaging Het
Itpr2 A G 6: 146,426,459 L92P probably damaging Het
Kcnk2 A G 1: 189,258,736 probably null Het
Krt75 T C 15: 101,572,764 T192A probably benign Het
Lrp1b T A 2: 41,269,187 K1694N Het
Lrrc14 A G 15: 76,714,531 K456E possibly damaging Het
Naip5 T A 13: 100,222,233 M832L probably benign Het
Nectin1 A G 9: 43,792,501 T263A probably benign Het
Nnt A T 13: 119,374,750 M330K probably damaging Het
Nrap T C 19: 56,320,251 N1711D possibly damaging Het
Olfm1 A G 2: 28,229,123 N285D possibly damaging Het
Olfr145 A T 9: 37,897,389 probably benign Het
Olfr32 T A 2: 90,138,815 E108V probably damaging Het
Olfr613 T A 7: 103,552,377 S197R possibly damaging Het
Pag1 A G 3: 9,699,422 Y224H probably damaging Het
Pde8a T C 7: 81,308,839 C322R possibly damaging Het
Pde8a A T 7: 81,317,370 T420S probably benign Het
Per2 A C 1: 91,435,703 L365R possibly damaging Het
Pml A G 9: 58,246,973 probably null Het
Ppp1r1a T A 15: 103,537,878 M1L possibly damaging Het
Ppp3r2 G T 4: 49,681,913 C12* probably null Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rsg1 A C 4: 141,220,037 Q243P probably damaging Het
Scyl1 C T 19: 5,760,592 R531Q possibly damaging Het
Skp2 C A 15: 9,139,600 V38F probably damaging Het
Slc27a3 A G 3: 90,389,667 C42R probably damaging Het
Tekt5 A G 16: 10,395,413 F3L probably benign Het
Tmem200c A G 17: 68,840,518 K32R probably benign Het
Tmprss11f T A 5: 86,528,273 R350W probably damaging Het
Tph2 A T 10: 115,179,594 I121N possibly damaging Het
Trim37 A G 11: 87,146,968 D176G possibly damaging Het
Trpc4 A T 3: 54,194,914 I78F probably damaging Het
Ttn T C 2: 76,779,485 K17526E probably damaging Het
Tuba8 A C 6: 121,222,873 Y172S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Urb2 A T 8: 124,028,032 R159S possibly damaging Het
Usp25 T A 16: 77,109,175 C840S probably damaging Het
Vmn1r36 T A 6: 66,715,980 K304* probably null Het
Vmn1r37 C A 6: 66,731,672 T94N probably damaging Het
Vmn2r7 T C 3: 64,707,058 N445S probably damaging Het
Wnk4 G A 11: 101,274,092 G749D probably benign Het
Wscd2 G A 5: 113,551,115 V61I probably benign Het
Zfp85 T A 13: 67,748,979 R325* probably null Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTGCAGGTTCAGTGTCTTCG -3'
(R):5'- GACCTAATGGAGCCAAATGAGC -3'

Sequencing Primer
(F):5'- CGATGAGTTGAGGCTCTCTAAG -3'
(R):5'- GCAGTGAGTACTACCAGTAACTGTC -3'
Posted On2020-01-23