Incidental Mutation 'R8047:Olfr1029'
ID618794
Institutional Source Beutler Lab
Gene Symbol Olfr1029
Ensembl Gene ENSMUSG00000059873
Gene Nameolfactory receptor 1029
SynonymsGA_x6K02T2Q125-47454152-47455126, MOR198-1P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85973895-85978913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85975927 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 228 (I228T)
Ref Sequence ENSEMBL: ENSMUSP00000150637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056849] [ENSMUST00000082191] [ENSMUST00000217244]
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082191
AA Change: I228T

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080828
Gene: ENSMUSG00000059873
AA Change: I228T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7tm_1 41 290 2.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217244
AA Change: I228T

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Olfr1029
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Olfr1029 APN 2 85975235 utr 5 prime probably benign
IGL02126:Olfr1029 APN 2 85976173 missense probably benign 0.00
IGL02584:Olfr1029 APN 2 85975875 missense probably damaging 0.96
IGL03410:Olfr1029 APN 2 85975420 missense probably damaging 0.99
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1499:Olfr1029 UTSW 2 85976028 missense possibly damaging 0.62
R1584:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R2925:Olfr1029 UTSW 2 85975781 nonsense probably null
R2970:Olfr1029 UTSW 2 85976110 missense possibly damaging 0.75
R4571:Olfr1029 UTSW 2 85975831 missense probably damaging 0.97
R5533:Olfr1029 UTSW 2 85975453 missense possibly damaging 0.78
R5654:Olfr1029 UTSW 2 85976156 missense probably benign 0.00
R5827:Olfr1029 UTSW 2 85975306 missense probably benign 0.00
R5967:Olfr1029 UTSW 2 85976191 missense probably benign 0.01
R6291:Olfr1029 UTSW 2 85975582 missense probably damaging 1.00
R6735:Olfr1029 UTSW 2 85975434 missense possibly damaging 0.81
R6897:Olfr1029 UTSW 2 85975356 missense possibly damaging 0.45
R7053:Olfr1029 UTSW 2 85976014 missense possibly damaging 0.64
R7163:Olfr1029 UTSW 2 85975588 missense probably damaging 1.00
R7358:Olfr1029 UTSW 2 85975436 missense possibly damaging 0.81
R8271:Olfr1029 UTSW 2 85975422 missense probably damaging 1.00
R8271:Olfr1029 UTSW 2 85975741 missense probably benign 0.40
R8364:Olfr1029 UTSW 2 85976014 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGGCTTCTCAGATGGACTATTC -3'
(R):5'- TGGATTCAGCAGAGGACTTAC -3'

Sequencing Primer
(F):5'- AAGCCATCTTGACCTTCAGTATGAC -3'
(R):5'- TTCAGCAGAGGACTTACAAAGGTG -3'
Posted On2020-01-23