Incidental Mutation 'R8047:4930402H24Rik'
ID618797
Institutional Source Beutler Lab
Gene Symbol 4930402H24Rik
Ensembl Gene ENSMUSG00000027309
Gene NameRIKEN cDNA 4930402H24 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130706200-130906406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130775099 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 439 (V439E)
Ref Sequence ENSEMBL: ENSMUSP00000046992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044766] [ENSMUST00000119422]
Predicted Effect probably damaging
Transcript: ENSMUST00000044766
AA Change: V439E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046992
Gene: ENSMUSG00000027309
AA Change: V439E

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 463 473 N/A INTRINSIC
low complexity region 533 545 N/A INTRINSIC
coiled coil region 1143 1171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119422
AA Change: V308E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113481
Gene: ENSMUSG00000027309
AA Change: V308E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 332 342 N/A INTRINSIC
low complexity region 402 414 N/A INTRINSIC
coiled coil region 1012 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145851
SMART Domains Protein: ENSMUSP00000118946
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an uncharacterized protein with a C-terminal coiled-coil region. The gene is located on chromosome 20p13 in a 1.8 Mb region linked to a spinocerebellar ataxia phenotype, but this gene does not appear to be a disease candidate. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in 4930402H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:4930402H24Rik APN 2 130784457 missense probably benign 0.00
IGL01093:4930402H24Rik APN 2 130777236 missense probably benign 0.01
IGL01111:4930402H24Rik APN 2 130736598 missense possibly damaging 0.66
IGL01146:4930402H24Rik APN 2 130770671 critical splice donor site probably null
IGL01346:4930402H24Rik APN 2 130791846 splice site probably benign
IGL01548:4930402H24Rik APN 2 130814259 missense probably damaging 1.00
IGL02339:4930402H24Rik APN 2 130739465 missense probably damaging 0.97
IGL02637:4930402H24Rik APN 2 130814307 intron probably benign
IGL02926:4930402H24Rik APN 2 130712366 missense probably benign 0.00
IGL02978:4930402H24Rik APN 2 130727162 missense probably damaging 0.99
IGL03126:4930402H24Rik APN 2 130791995 splice site probably null
IGL03387:4930402H24Rik APN 2 130717280 missense probably damaging 1.00
best_times UTSW 2 130736576 missense probably damaging 0.99
Hard_times UTSW 2 130713470 missense probably benign 0.16
worst_times UTSW 2 130713414 missense probably damaging 1.00
FR4304:4930402H24Rik UTSW 2 130770748 small insertion probably benign
FR4342:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770745 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4737:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770739 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770753 small insertion probably benign
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0357:4930402H24Rik UTSW 2 130712946 splice site probably benign
R0379:4930402H24Rik UTSW 2 130785546 splice site probably benign
R0515:4930402H24Rik UTSW 2 130740488 missense probably damaging 1.00
R0576:4930402H24Rik UTSW 2 130713470 missense probably benign 0.16
R0811:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R0812:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R1334:4930402H24Rik UTSW 2 130775722 splice site probably null
R1485:4930402H24Rik UTSW 2 130748683 critical splice donor site probably null
R1486:4930402H24Rik UTSW 2 130737418 missense probably damaging 1.00
R1670:4930402H24Rik UTSW 2 130712379 missense probably damaging 1.00
R1678:4930402H24Rik UTSW 2 130814273 missense probably damaging 0.99
R1700:4930402H24Rik UTSW 2 130709938 missense probably damaging 0.99
R1742:4930402H24Rik UTSW 2 130740395 splice site probably null
R2046:4930402H24Rik UTSW 2 130810917 missense possibly damaging 0.61
R2374:4930402H24Rik UTSW 2 130820574 missense probably damaging 1.00
R3878:4930402H24Rik UTSW 2 130778503 missense possibly damaging 0.92
R3907:4930402H24Rik UTSW 2 130736576 missense probably damaging 0.99
R4467:4930402H24Rik UTSW 2 130767647 missense probably damaging 0.96
R4931:4930402H24Rik UTSW 2 130741873 missense possibly damaging 0.58
R5098:4930402H24Rik UTSW 2 130798181 missense probably damaging 0.99
R5191:4930402H24Rik UTSW 2 130737403 missense possibly damaging 0.68
R5313:4930402H24Rik UTSW 2 130709268 missense probably damaging 1.00
R5405:4930402H24Rik UTSW 2 130712460 missense probably damaging 1.00
R5436:4930402H24Rik UTSW 2 130764499 missense probably benign 0.16
R5522:4930402H24Rik UTSW 2 130814302 intron probably benign
R5783:4930402H24Rik UTSW 2 130739083 missense possibly damaging 0.59
R5931:4930402H24Rik UTSW 2 130814189 missense probably damaging 1.00
R6145:4930402H24Rik UTSW 2 130778473 missense probably benign
R6732:4930402H24Rik UTSW 2 130810820 critical splice donor site probably null
R6938:4930402H24Rik UTSW 2 130775753 missense probably benign 0.00
R7161:4930402H24Rik UTSW 2 130806788 missense unknown
R7193:4930402H24Rik UTSW 2 130806788 missense unknown
R7194:4930402H24Rik UTSW 2 130806788 missense unknown
R7233:4930402H24Rik UTSW 2 130806788 missense unknown
R7234:4930402H24Rik UTSW 2 130806788 missense unknown
R7238:4930402H24Rik UTSW 2 130806788 missense unknown
R7239:4930402H24Rik UTSW 2 130806788 missense unknown
R7268:4930402H24Rik UTSW 2 130806788 missense unknown
R7807:4930402H24Rik UTSW 2 130710865 missense probably damaging 1.00
R7904:4930402H24Rik UTSW 2 130792003 splice site probably null
R7999:4930402H24Rik UTSW 2 130737452 missense probably benign 0.00
R8286:4930402H24Rik UTSW 2 130717328 missense probably damaging 1.00
R8315:4930402H24Rik UTSW 2 130770735 small deletion probably benign
RF027:4930402H24Rik UTSW 2 130770744 small insertion probably benign
RF038:4930402H24Rik UTSW 2 130770744 nonsense probably null
RF046:4930402H24Rik UTSW 2 130770734 nonsense probably null
RF048:4930402H24Rik UTSW 2 130770734 nonsense probably null
Z1177:4930402H24Rik UTSW 2 130710867 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCACAAGGCTGTCACAATCTC -3'
(R):5'- TTCCAGTGCTAATTCTGTACACATG -3'

Sequencing Primer
(F):5'- AATCTCAGCTGCCTGCAG -3'
(R):5'- CTGTACACATGTAACCCAATGCTTG -3'
Posted On2020-01-23