Incidental Mutation 'R8047:Plk4'
ID618800
Institutional Source Beutler Lab
Gene Symbol Plk4
Ensembl Gene ENSMUSG00000025758
Gene Namepolo like kinase 4
SynonymsStk18, Sak
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location40800019-40816883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40805752 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 361 (I361T)
Ref Sequence ENSEMBL: ENSMUSP00000026858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026858] [ENSMUST00000167556] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204473]
PDB Structure
Murine Sak Polo Domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026858
AA Change: I361T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026858
Gene: ENSMUSG00000025758
AA Change: I361T

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 774 6e-41 PDB
low complexity region 820 831 N/A INTRINSIC
Pfam:POLO_box 849 910 7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167556
AA Change: I361T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126945
Gene: ENSMUSG00000025758
AA Change: I361T

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 551 771 6e-41 PDB
low complexity region 817 828 N/A INTRINSIC
Pfam:POLO_box 844 908 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203295
AA Change: I361T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758
AA Change: I361T

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 747 3e-32 PDB
low complexity region 793 804 N/A INTRINSIC
Pfam:POLO_box 822 883 6.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203895
SMART Domains Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
STYKc 12 143 3.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204473
SMART Domains Protein: ENSMUSP00000144693
Gene: ENSMUSG00000025758

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 13 114 4.9e-17 PFAM
Pfam:Pkinase 13 115 2.4e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to the nucleolus during G2, to centrosomes during G2/M, and to the cleavage furrow during cytokinesis. It is required for progression through mitosis, cell survival, and embryonic development. The mouse genome contains a pseudogene similar to this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene die before birth. Development is arrested around E7.5. Mice heterozygous for an ENU-induced allele or gene trap alele exhibit male hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Plk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Plk4 APN 3 40801789 missense probably damaging 1.00
IGL01730:Plk4 APN 3 40805850 missense probably benign 0.00
IGL01906:Plk4 APN 3 40810381 missense probably null 0.01
IGL02021:Plk4 APN 3 40810708 missense probably damaging 0.97
IGL02718:Plk4 APN 3 40815021 missense probably damaging 1.00
IGL03287:Plk4 APN 3 40805118 missense probably benign 0.11
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0312:Plk4 UTSW 3 40813547 missense probably damaging 0.97
R0387:Plk4 UTSW 3 40812884 splice site probably benign
R0411:Plk4 UTSW 3 40811219 unclassified probably benign
R0480:Plk4 UTSW 3 40805640 missense probably benign 0.15
R1170:Plk4 UTSW 3 40801847 missense probably damaging 1.00
R1268:Plk4 UTSW 3 40811369 missense probably damaging 1.00
R1529:Plk4 UTSW 3 40806536 missense probably benign 0.09
R1987:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R1988:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R2050:Plk4 UTSW 3 40810380 missense probably benign
R4409:Plk4 UTSW 3 40806549 missense probably damaging 0.98
R4727:Plk4 UTSW 3 40805154 missense probably benign 0.00
R4765:Plk4 UTSW 3 40802022 missense probably damaging 1.00
R4772:Plk4 UTSW 3 40805190 missense probably damaging 1.00
R5022:Plk4 UTSW 3 40802077 splice site probably null
R5363:Plk4 UTSW 3 40801984 missense possibly damaging 0.71
R5651:Plk4 UTSW 3 40813505 missense probably benign 0.00
R5665:Plk4 UTSW 3 40813586 missense possibly damaging 0.79
R5724:Plk4 UTSW 3 40801046 missense probably damaging 1.00
R6391:Plk4 UTSW 3 40808973 missense probably benign 0.05
R6694:Plk4 UTSW 3 40801828 missense probably damaging 1.00
R7412:Plk4 UTSW 3 40812178 missense probably benign
R8165:Plk4 UTSW 3 40813574 missense probably damaging 0.99
R8399:Plk4 UTSW 3 40808830 nonsense probably null
R8411:Plk4 UTSW 3 40813466 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGGCATGCTACACTTTCC -3'
(R):5'- TACCTGTGTTGATTTTCATCCAGTG -3'

Sequencing Primer
(F):5'- TACCAGTTTGAGTGGCAGCCTAC -3'
(R):5'- CCAGTGATCTTCTAGGCTTTGAAAG -3'
Posted On2020-01-23