Incidental Mutation 'R8047:Lrrc69'
ID618802
Institutional Source Beutler Lab
Gene Symbol Lrrc69
Ensembl Gene ENSMUSG00000023151
Gene Nameleucine rich repeat containing 69
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location14623620-14796060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14773726 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 110 (I110N)
Ref Sequence ENSEMBL: ENSMUSP00000023917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023917] [ENSMUST00000108276]
Predicted Effect probably benign
Transcript: ENSMUST00000023917
AA Change: I110N

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023917
Gene: ENSMUSG00000023151
AA Change: I110N

DomainStartEndE-ValueType
LRR 36 58 4.57e0 SMART
LRR 59 81 2.82e0 SMART
LRR 82 105 7.55e-1 SMART
LRR 106 128 7.79e0 SMART
LRR 129 151 1.99e0 SMART
LRR 152 174 5.72e0 SMART
LRR 175 197 3.86e0 SMART
LRR 198 220 8.24e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108276
AA Change: I110N

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103911
Gene: ENSMUSG00000023151
AA Change: I110N

DomainStartEndE-ValueType
LRR 36 58 4.57e0 SMART
LRR 59 81 2.82e0 SMART
LRR 82 105 7.55e-1 SMART
LRR 106 128 7.79e0 SMART
LRR 129 151 1.99e0 SMART
LRR 152 174 5.72e0 SMART
LRR 175 197 3.86e0 SMART
LRR 198 220 8.24e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Lrrc69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Lrrc69 APN 4 14773663 splice site probably benign
IGL01886:Lrrc69 APN 4 14703984 missense probably benign 0.01
IGL03084:Lrrc69 APN 4 14708631 missense probably damaging 1.00
R0588:Lrrc69 UTSW 4 14704001 missense possibly damaging 0.71
R1664:Lrrc69 UTSW 4 14775079 missense probably damaging 1.00
R1956:Lrrc69 UTSW 4 14665986 missense possibly damaging 0.50
R1984:Lrrc69 UTSW 4 14708669 missense possibly damaging 0.93
R1985:Lrrc69 UTSW 4 14708669 missense possibly damaging 0.93
R1986:Lrrc69 UTSW 4 14708669 missense possibly damaging 0.93
R2229:Lrrc69 UTSW 4 14773694 missense probably benign 0.00
R3691:Lrrc69 UTSW 4 14795980 missense possibly damaging 0.94
R5691:Lrrc69 UTSW 4 14769648 missense probably damaging 1.00
R5882:Lrrc69 UTSW 4 14708690 missense probably damaging 1.00
R6113:Lrrc69 UTSW 4 14708673 missense probably benign 0.00
R7228:Lrrc69 UTSW 4 14775027 missense probably damaging 1.00
R7880:Lrrc69 UTSW 4 14703946 missense possibly damaging 0.90
R8375:Lrrc69 UTSW 4 14795994 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ATCAGTAGCTTGCTTCACATTTCTG -3'
(R):5'- CTGCTTAGTCCTTAGGTCCAGTTTG -3'

Sequencing Primer
(F):5'- GTTATCTGTAACCACCCTAACTAGG -3'
(R):5'- GTCCTCAGTGTCCTATGTGACAC -3'
Posted On2020-01-23