Incidental Mutation 'R8047:Kif1b'
ID618804
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Namekinesin family member 1B
SynonymsKif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location149176319-149307693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 149214922 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1010 (V1010L)
Ref Sequence ENSEMBL: ENSMUSP00000056754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]
Predicted Effect probably damaging
Transcript: ENSMUST00000055647
AA Change: V964L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: V964L

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060537
AA Change: V1010L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: V1010L

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149220602 missense probably damaging 1.00
IGL01943:Kif1b APN 4 149214905 critical splice donor site probably null
IGL02240:Kif1b APN 4 149246414 missense probably damaging 1.00
IGL02414:Kif1b APN 4 149199314 missense probably damaging 0.96
IGL02490:Kif1b APN 4 149204208 missense probably benign
IGL02501:Kif1b APN 4 149214976 missense probably damaging 1.00
IGL02833:Kif1b APN 4 149246364 missense probably damaging 1.00
IGL02852:Kif1b APN 4 149291328 missense probably damaging 1.00
IGL02900:Kif1b APN 4 149180809 missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149214981 missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149274939 missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149220792 critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149181927 missense probably damaging 1.00
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0129:Kif1b UTSW 4 149261201 missense probably benign
R0180:Kif1b UTSW 4 149213659 missense probably damaging 1.00
R0288:Kif1b UTSW 4 149199338 missense probably damaging 1.00
R0360:Kif1b UTSW 4 149262729 missense probably damaging 1.00
R0383:Kif1b UTSW 4 149202512 missense probably damaging 1.00
R0398:Kif1b UTSW 4 149204231 missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149181967 nonsense probably null
R0445:Kif1b UTSW 4 149188009 missense probably benign 0.01
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1681:Kif1b UTSW 4 149195501 critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149187722 missense probably damaging 0.99
R1840:Kif1b UTSW 4 149188132 missense probably damaging 1.00
R1874:Kif1b UTSW 4 149187632 missense probably benign
R1915:Kif1b UTSW 4 149267216 missense probably damaging 1.00
R2106:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149222296 missense probably benign 0.08
R2126:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149184309 missense probably damaging 0.99
R2255:Kif1b UTSW 4 149274997 missense probably damaging 1.00
R2392:Kif1b UTSW 4 149220620 missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149237648 missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149220541 critical splice donor site probably null
R3038:Kif1b UTSW 4 149213333 missense probably benign 0.02
R3616:Kif1b UTSW 4 149262283 splice site probably benign
R3935:Kif1b UTSW 4 149237160 missense probably benign 0.00
R4347:Kif1b UTSW 4 149247234 missense probably damaging 1.00
R4423:Kif1b UTSW 4 149214105 missense probably damaging 0.99
R4637:Kif1b UTSW 4 149199311 missense probably damaging 0.97
R4745:Kif1b UTSW 4 149237882 nonsense probably null
R4807:Kif1b UTSW 4 149247921 intron probably benign
R5618:Kif1b UTSW 4 149269889 missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149238482 missense probably damaging 0.96
R5683:Kif1b UTSW 4 149222261 missense probably damaging 1.00
R5696:Kif1b UTSW 4 149273849 splice site probably null
R6022:Kif1b UTSW 4 149198532 missense probably benign 0.01
R6048:Kif1b UTSW 4 149263629 missense probably damaging 1.00
R6137:Kif1b UTSW 4 149238426 missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149237532 missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149258048 missense probably damaging 1.00
R6250:Kif1b UTSW 4 149213643 missense probably benign 0.00
R6423:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6424:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6425:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6443:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6460:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6462:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6463:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6469:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6470:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6471:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6472:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6504:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6536:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6537:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6668:Kif1b UTSW 4 149213407 missense probably benign 0.09
R6698:Kif1b UTSW 4 149274956 missense probably damaging 0.99
R7065:Kif1b UTSW 4 149202525 missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149225157 missense probably damaging 1.00
R7342:Kif1b UTSW 4 149214090 missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149182355 missense probably benign 0.01
R7744:Kif1b UTSW 4 149237075 missense possibly damaging 0.83
R7797:Kif1b UTSW 4 149237387 missense probably benign
R7829:Kif1b UTSW 4 149220990 splice site probably null
R7869:Kif1b UTSW 4 149184376 missense probably benign 0.01
R7878:Kif1b UTSW 4 149214997 missense probably damaging 0.98
R7980:Kif1b UTSW 4 149269921 missense probably damaging 1.00
R8237:Kif1b UTSW 4 149191185 missense probably benign 0.10
R8243:Kif1b UTSW 4 149204267 missense probably benign
R8252:Kif1b UTSW 4 149273805 missense probably damaging 1.00
R8342:Kif1b UTSW 4 149222348 missense probably damaging 0.96
R8460:Kif1b UTSW 4 149187620 missense possibly damaging 0.93
RF008:Kif1b UTSW 4 149251738 splice site probably null
X0009:Kif1b UTSW 4 149247264 missense probably damaging 1.00
X0062:Kif1b UTSW 4 149275005 missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149266298 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCATCAAGAAGCTAGCTTGC -3'
(R):5'- CAGAAGCCAGTTGAGTTTGGG -3'

Sequencing Primer
(F):5'- GTCTTCTGTAAGAGCAGCCAGTAC -3'
(R):5'- CCAGTTGAGTTTGGGGAGGC -3'
Posted On2020-01-23