Incidental Mutation 'R8047:Kif1b'
ID 618804
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Name kinesin family member 1B
Synonyms N-3 kinesin, KIF1Bp130, KIF1Bp204, Kif1b beta, Kif1b alpha, D4Mil1e, A530096N05Rik
MMRRC Submission 067484-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8047 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 149260776-149392150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 149299379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1010 (V1010L)
Ref Sequence ENSEMBL: ENSMUSP00000056754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]
AlphaFold Q60575
Predicted Effect probably damaging
Transcript: ENSMUST00000055647
AA Change: V964L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: V964L

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060537
AA Change: V1010L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: V1010L

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 80,427,817 (GRCm39) T157I possibly damaging Het
Cd200l2 T C 16: 45,340,829 (GRCm39) I245V probably benign Het
Cdh22 G A 2: 165,012,687 (GRCm39) R133W probably damaging Het
Cep152 A T 2: 125,406,247 (GRCm39) N1428K probably benign Het
Clstn3 T A 6: 124,408,972 (GRCm39) D892V possibly damaging Het
Coch G A 12: 51,650,496 (GRCm39) probably null Het
D6Ertd527e G T 6: 87,088,454 (GRCm39) V206F unknown Het
Dnaaf9 A T 2: 130,617,019 (GRCm39) V439E probably damaging Het
Dock3 T C 9: 106,870,208 (GRCm39) I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 (GRCm39) S20P probably benign Het
Eef1e1 T C 13: 38,830,222 (GRCm39) Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,758,003 (GRCm39) probably benign Het
Engase T C 11: 118,377,282 (GRCm39) S526P probably benign Het
Fbxo40 T A 16: 36,790,231 (GRCm39) D293V probably damaging Het
Gipc3 T A 10: 81,177,132 (GRCm39) N146I probably damaging Het
Gm11569 T C 11: 99,689,616 (GRCm39) T28A unknown Het
Gm43302 T C 5: 105,422,623 (GRCm39) I470V possibly damaging Het
Gpihbp1 A G 15: 75,469,627 (GRCm39) Q114R possibly damaging Het
Grhl2 T A 15: 37,336,465 (GRCm39) M454K probably benign Het
Gsap A T 5: 21,462,866 (GRCm39) probably null Het
Ighv6-5 T C 12: 114,380,191 (GRCm39) probably null Het
Krt8 A T 15: 101,912,406 (GRCm39) I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 (GRCm39) I110N probably benign Het
Lta T C 17: 35,423,011 (GRCm39) Y104C probably damaging Het
Madd A G 2: 91,009,546 (GRCm39) Y13H probably damaging Het
Mccc2 C T 13: 100,091,181 (GRCm39) V439I probably benign Het
Mecom T A 3: 30,292,404 (GRCm39) D35V Het
Msra C T 14: 64,522,612 (GRCm39) A76T probably damaging Het
Myo18b G T 5: 112,871,681 (GRCm39) D2133E possibly damaging Het
Ncapd2 C T 6: 125,166,762 (GRCm39) V31M probably damaging Het
Npc1 A G 18: 12,346,374 (GRCm39) V274A probably benign Het
Or5m11b T C 2: 85,806,271 (GRCm39) I228T possibly damaging Het
Patz1 C T 11: 3,256,283 (GRCm39) P523L probably benign Het
Pbx2 T C 17: 34,814,262 (GRCm39) S350P probably benign Het
Plk4 T C 3: 40,760,187 (GRCm39) I361T probably benign Het
Ppat G T 5: 77,073,557 (GRCm39) N122K probably damaging Het
Prss23 T A 7: 89,159,136 (GRCm39) Q311L probably damaging Het
Psg26 G T 7: 18,212,474 (GRCm39) Q294K possibly damaging Het
Rab3il1 G T 19: 10,011,166 (GRCm39) R285L probably benign Het
Radil A G 5: 142,480,695 (GRCm39) C587R probably damaging Het
Rd3 A T 1: 191,709,620 (GRCm39) probably benign Het
Reck T C 4: 43,927,221 (GRCm39) L504P probably damaging Het
Rmc1 C T 18: 12,313,586 (GRCm39) T233M possibly damaging Het
Selenov A C 7: 27,990,108 (GRCm39) L132R probably benign Het
Spag16 A T 1: 69,882,155 (GRCm39) D49V probably damaging Het
Ston2 C T 12: 91,608,617 (GRCm39) V828I probably damaging Het
Tiam1 A G 16: 89,694,672 (GRCm39) S262P probably benign Het
Tlnrd1 A T 7: 83,532,069 (GRCm39) S121T probably damaging Het
Unc13c T A 9: 73,719,636 (GRCm39) K1011* probably null Het
Vmn2r89 T A 14: 51,692,549 (GRCm39) D117E probably benign Het
Zbtb7c A C 18: 76,270,221 (GRCm39) N103T probably damaging Het
Zfp764 T C 7: 127,005,412 (GRCm39) E75G probably damaging Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149,305,059 (GRCm39) missense probably damaging 1.00
IGL01943:Kif1b APN 4 149,299,362 (GRCm39) critical splice donor site probably null
IGL02240:Kif1b APN 4 149,330,871 (GRCm39) missense probably damaging 1.00
IGL02414:Kif1b APN 4 149,283,771 (GRCm39) missense probably damaging 0.96
IGL02490:Kif1b APN 4 149,288,665 (GRCm39) missense probably benign
IGL02501:Kif1b APN 4 149,299,433 (GRCm39) missense probably damaging 1.00
IGL02833:Kif1b APN 4 149,330,821 (GRCm39) missense probably damaging 1.00
IGL02852:Kif1b APN 4 149,375,785 (GRCm39) missense probably damaging 1.00
IGL02900:Kif1b APN 4 149,265,266 (GRCm39) missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149,299,438 (GRCm39) missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149,359,396 (GRCm39) missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149,305,249 (GRCm39) critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149,266,384 (GRCm39) missense probably damaging 1.00
R0044:Kif1b UTSW 4 149,348,058 (GRCm39) splice site probably benign
R0044:Kif1b UTSW 4 149,348,058 (GRCm39) splice site probably benign
R0129:Kif1b UTSW 4 149,345,658 (GRCm39) missense probably benign
R0180:Kif1b UTSW 4 149,298,116 (GRCm39) missense probably damaging 1.00
R0288:Kif1b UTSW 4 149,283,795 (GRCm39) missense probably damaging 1.00
R0360:Kif1b UTSW 4 149,347,186 (GRCm39) missense probably damaging 1.00
R0383:Kif1b UTSW 4 149,286,969 (GRCm39) missense probably damaging 1.00
R0398:Kif1b UTSW 4 149,288,688 (GRCm39) missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149,266,424 (GRCm39) nonsense probably null
R0445:Kif1b UTSW 4 149,272,466 (GRCm39) missense probably benign 0.01
R1466:Kif1b UTSW 4 149,307,709 (GRCm39) missense probably damaging 0.99
R1466:Kif1b UTSW 4 149,307,709 (GRCm39) missense probably damaging 0.99
R1681:Kif1b UTSW 4 149,279,958 (GRCm39) critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149,272,179 (GRCm39) missense probably damaging 0.99
R1840:Kif1b UTSW 4 149,272,589 (GRCm39) missense probably damaging 1.00
R1874:Kif1b UTSW 4 149,272,089 (GRCm39) missense probably benign
R1915:Kif1b UTSW 4 149,351,673 (GRCm39) missense probably damaging 1.00
R2106:Kif1b UTSW 4 149,272,097 (GRCm39) missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149,306,753 (GRCm39) missense probably benign 0.08
R2126:Kif1b UTSW 4 149,272,097 (GRCm39) missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149,272,097 (GRCm39) missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149,272,097 (GRCm39) missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149,272,097 (GRCm39) missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149,268,766 (GRCm39) missense probably damaging 0.99
R2255:Kif1b UTSW 4 149,359,454 (GRCm39) missense probably damaging 1.00
R2392:Kif1b UTSW 4 149,305,077 (GRCm39) missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149,322,105 (GRCm39) missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149,304,998 (GRCm39) critical splice donor site probably null
R3038:Kif1b UTSW 4 149,297,790 (GRCm39) missense probably benign 0.02
R3616:Kif1b UTSW 4 149,346,740 (GRCm39) splice site probably benign
R3935:Kif1b UTSW 4 149,321,617 (GRCm39) missense probably benign 0.00
R4347:Kif1b UTSW 4 149,331,691 (GRCm39) missense probably damaging 1.00
R4423:Kif1b UTSW 4 149,298,562 (GRCm39) missense probably damaging 0.99
R4637:Kif1b UTSW 4 149,283,768 (GRCm39) missense probably damaging 0.97
R4745:Kif1b UTSW 4 149,322,339 (GRCm39) nonsense probably null
R4807:Kif1b UTSW 4 149,332,378 (GRCm39) intron probably benign
R5618:Kif1b UTSW 4 149,354,346 (GRCm39) missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149,322,939 (GRCm39) missense probably damaging 0.96
R5683:Kif1b UTSW 4 149,306,718 (GRCm39) missense probably damaging 1.00
R5696:Kif1b UTSW 4 149,358,306 (GRCm39) splice site probably null
R6022:Kif1b UTSW 4 149,282,989 (GRCm39) missense probably benign 0.01
R6048:Kif1b UTSW 4 149,348,086 (GRCm39) missense probably damaging 1.00
R6137:Kif1b UTSW 4 149,322,883 (GRCm39) missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149,321,989 (GRCm39) missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149,342,505 (GRCm39) missense probably damaging 1.00
R6250:Kif1b UTSW 4 149,298,100 (GRCm39) missense probably benign 0.00
R6423:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6424:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6425:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6443:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6460:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6462:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6463:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6469:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6470:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6471:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6472:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6504:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6536:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6537:Kif1b UTSW 4 149,277,053 (GRCm39) missense probably benign 0.16
R6668:Kif1b UTSW 4 149,297,864 (GRCm39) missense probably benign 0.09
R6698:Kif1b UTSW 4 149,359,413 (GRCm39) missense probably damaging 0.99
R7065:Kif1b UTSW 4 149,286,982 (GRCm39) missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149,309,614 (GRCm39) missense probably damaging 1.00
R7342:Kif1b UTSW 4 149,298,547 (GRCm39) missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149,266,812 (GRCm39) missense probably benign 0.01
R7744:Kif1b UTSW 4 149,321,532 (GRCm39) missense possibly damaging 0.83
R7797:Kif1b UTSW 4 149,321,844 (GRCm39) missense probably benign
R7829:Kif1b UTSW 4 149,305,447 (GRCm39) splice site probably null
R7869:Kif1b UTSW 4 149,268,833 (GRCm39) missense probably benign 0.01
R7878:Kif1b UTSW 4 149,299,454 (GRCm39) missense probably damaging 0.98
R7980:Kif1b UTSW 4 149,354,378 (GRCm39) missense probably damaging 1.00
R8237:Kif1b UTSW 4 149,275,642 (GRCm39) missense probably benign 0.10
R8243:Kif1b UTSW 4 149,288,724 (GRCm39) missense probably benign
R8252:Kif1b UTSW 4 149,358,262 (GRCm39) missense probably damaging 1.00
R8342:Kif1b UTSW 4 149,306,805 (GRCm39) missense probably damaging 0.96
R8460:Kif1b UTSW 4 149,272,077 (GRCm39) missense possibly damaging 0.93
R8462:Kif1b UTSW 4 149,266,797 (GRCm39) missense probably benign 0.05
R8496:Kif1b UTSW 4 149,277,068 (GRCm39) nonsense probably null
R8687:Kif1b UTSW 4 149,345,620 (GRCm39) nonsense probably null
R8694:Kif1b UTSW 4 149,305,024 (GRCm39) missense probably damaging 0.98
R8842:Kif1b UTSW 4 149,338,196 (GRCm39) missense probably damaging 0.98
R8883:Kif1b UTSW 4 149,361,342 (GRCm39) missense probably benign
R8971:Kif1b UTSW 4 149,332,273 (GRCm39) missense probably damaging 1.00
R8994:Kif1b UTSW 4 149,279,939 (GRCm39) missense
R9002:Kif1b UTSW 4 149,275,712 (GRCm39) missense probably damaging 0.96
R9227:Kif1b UTSW 4 149,322,357 (GRCm39) missense probably damaging 1.00
R9231:Kif1b UTSW 4 149,275,652 (GRCm39) missense possibly damaging 0.94
R9450:Kif1b UTSW 4 149,322,467 (GRCm39) missense probably benign 0.01
R9478:Kif1b UTSW 4 149,345,616 (GRCm39) critical splice donor site probably null
R9571:Kif1b UTSW 4 149,305,098 (GRCm39) missense probably damaging 1.00
R9644:Kif1b UTSW 4 149,375,836 (GRCm39) missense probably damaging 1.00
RF008:Kif1b UTSW 4 149,336,195 (GRCm39) splice site probably null
X0009:Kif1b UTSW 4 149,331,721 (GRCm39) missense probably damaging 1.00
X0062:Kif1b UTSW 4 149,359,462 (GRCm39) missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149,350,755 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCATCAAGAAGCTAGCTTGC -3'
(R):5'- CAGAAGCCAGTTGAGTTTGGG -3'

Sequencing Primer
(F):5'- GTCTTCTGTAAGAGCAGCCAGTAC -3'
(R):5'- CCAGTTGAGTTTGGGGAGGC -3'
Posted On 2020-01-23