Incidental Mutation 'R8047:Gsap'
ID618805
Institutional Source Beutler Lab
Gene Symbol Gsap
Ensembl Gene ENSMUSG00000039934
Gene Namegamma-secretase activating protein
SynonymsA530088I07Rik, Pion
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location21186255-21315132 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 21257868 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198937]
Predicted Effect probably null
Transcript: ENSMUST00000036031
SMART Domains Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934

DomainStartEndE-ValueType
low complexity region 386 398 N/A INTRINSIC
Pfam:GSAP-16 646 753 6.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195969
Predicted Effect probably benign
Transcript: ENSMUST00000198014
Predicted Effect probably benign
Transcript: ENSMUST00000198937
SMART Domains Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934

DomainStartEndE-ValueType
low complexity region 355 367 N/A INTRINSIC
Pfam:GSAP-16 608 722 1.6e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Gsap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Gsap APN 5 21221305 splice site probably benign
IGL00788:Gsap APN 5 21254024 missense probably damaging 0.96
IGL01344:Gsap APN 5 21242883 critical splice donor site probably null
IGL01347:Gsap APN 5 21226320 missense probably benign 0.08
IGL01618:Gsap APN 5 21226248 missense probably damaging 1.00
IGL01730:Gsap APN 5 21290154 unclassified probably benign
IGL02061:Gsap APN 5 21281611 splice site probably benign
IGL02161:Gsap APN 5 21253379 missense probably damaging 1.00
IGL02259:Gsap APN 5 21186400 missense probably benign 0.01
IGL02635:Gsap APN 5 21289816 missense probably damaging 1.00
IGL02684:Gsap APN 5 21242803 critical splice acceptor site probably null
IGL02822:Gsap APN 5 21217444 missense probably damaging 1.00
IGL03231:Gsap APN 5 21229166 missense probably damaging 0.99
PIT4305001:Gsap UTSW 5 21186409 missense probably damaging 0.98
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0045:Gsap UTSW 5 21226832 missense possibly damaging 0.77
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0409:Gsap UTSW 5 21222445 splice site probably benign
R0507:Gsap UTSW 5 21269963 missense possibly damaging 0.75
R0624:Gsap UTSW 5 21253951 splice site probably null
R1037:Gsap UTSW 5 21251165 splice site probably benign
R1076:Gsap UTSW 5 21287694 missense possibly damaging 0.75
R1459:Gsap UTSW 5 21207238 splice site probably benign
R1757:Gsap UTSW 5 21281037 missense probably damaging 0.98
R1852:Gsap UTSW 5 21290545 splice site probably null
R2034:Gsap UTSW 5 21270595 missense probably damaging 1.00
R2069:Gsap UTSW 5 21226839 splice site probably benign
R2125:Gsap UTSW 5 21242813 missense probably damaging 1.00
R2172:Gsap UTSW 5 21222440 critical splice donor site probably null
R2310:Gsap UTSW 5 21196090 nonsense probably null
R2337:Gsap UTSW 5 21288630 missense probably damaging 1.00
R3442:Gsap UTSW 5 21278127 missense probably damaging 1.00
R4229:Gsap UTSW 5 21246977 missense probably benign 0.00
R4271:Gsap UTSW 5 21226350 critical splice donor site probably null
R4551:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4553:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4649:Gsap UTSW 5 21226311 missense probably damaging 1.00
R4687:Gsap UTSW 5 21246971 utr 3 prime probably benign
R4799:Gsap UTSW 5 21250943 missense probably benign 0.05
R4857:Gsap UTSW 5 21287799 splice site probably null
R4973:Gsap UTSW 5 21254039 missense probably benign 0.04
R5015:Gsap UTSW 5 21222408 missense probably damaging 1.00
R5031:Gsap UTSW 5 21242826 missense possibly damaging 0.57
R5120:Gsap UTSW 5 21269936 missense probably damaging 0.96
R5451:Gsap UTSW 5 21217447 missense probably damaging 1.00
R5469:Gsap UTSW 5 21290544 missense possibly damaging 0.92
R5519:Gsap UTSW 5 21289859 missense probably damaging 1.00
R5588:Gsap UTSW 5 21251149 missense probably damaging 1.00
R5650:Gsap UTSW 5 21251053 missense probably damaging 0.99
R6064:Gsap UTSW 5 21229225 missense possibly damaging 0.56
R6139:Gsap UTSW 5 21281540 missense probably damaging 1.00
R6148:Gsap UTSW 5 21226325 missense probably damaging 1.00
R6148:Gsap UTSW 5 21270577 missense probably benign 0.39
R6226:Gsap UTSW 5 21217431 missense probably damaging 1.00
R6859:Gsap UTSW 5 21281018 missense probably damaging 0.99
R6977:Gsap UTSW 5 21271221 missense probably damaging 1.00
R6995:Gsap UTSW 5 21271237 missense possibly damaging 0.58
R7013:Gsap UTSW 5 21278110 missense probably benign 0.39
R7159:Gsap UTSW 5 21270620 splice site probably null
R7181:Gsap UTSW 5 21253429 missense probably damaging 1.00
R7234:Gsap UTSW 5 21186435 missense probably benign
R7332:Gsap UTSW 5 21290121 missense probably benign 0.00
R7381:Gsap UTSW 5 21226787 missense probably damaging 0.96
R8062:Gsap UTSW 5 21194463 missense probably damaging 1.00
R8126:Gsap UTSW 5 21270012 missense probably benign 0.04
R8219:Gsap UTSW 5 21251115 missense probably benign 0.00
Z1177:Gsap UTSW 5 21251032 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTAGGTGGGCGAAATGAGTTC -3'
(R):5'- TTACGCAGGCTCTTCAGAAG -3'

Sequencing Primer
(F):5'- CTTAGGGCACAACAGAAG -3'
(R):5'- AGGCTCTTCAGAAGGACTCTCAG -3'
Posted On2020-01-23