Incidental Mutation 'R8047:Radil'
ID618810
Institutional Source Beutler Lab
Gene Symbol Radil
Ensembl Gene ENSMUSG00000029576
Gene NameRas association and DIL domains
SynonymsD930005D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location142484839-142551098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142494940 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 587 (C587R)
Ref Sequence ENSEMBL: ENSMUSP00000064539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063635] [ENSMUST00000085758] [ENSMUST00000110784] [ENSMUST00000110785]
Predicted Effect probably damaging
Transcript: ENSMUST00000063635
AA Change: C587R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064539
Gene: ENSMUSG00000029576
AA Change: C587R

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 950 964 N/A INTRINSIC
PDZ 979 1056 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085758
AA Change: C616R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082910
Gene: ENSMUSG00000029576
AA Change: C616R

DomainStartEndE-ValueType
RA 90 193 1.68e-15 SMART
Blast:FHA 294 361 2e-25 BLAST
low complexity region 373 383 N/A INTRINSIC
low complexity region 579 589 N/A INTRINSIC
DIL 663 772 6.19e-34 SMART
low complexity region 979 993 N/A INTRINSIC
PDZ 1008 1085 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110784
AA Change: C347R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106411
Gene: ENSMUSG00000029576
AA Change: C347R

DomainStartEndE-ValueType
Blast:FHA 25 92 3e-25 BLAST
low complexity region 104 114 N/A INTRINSIC
low complexity region 310 320 N/A INTRINSIC
DIL 394 503 6.19e-34 SMART
low complexity region 710 724 N/A INTRINSIC
PDZ 739 816 3.86e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110785
AA Change: C587R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106412
Gene: ENSMUSG00000029576
AA Change: C587R

DomainStartEndE-ValueType
RA 61 164 1.68e-15 SMART
Blast:FHA 265 332 2e-25 BLAST
low complexity region 344 354 N/A INTRINSIC
low complexity region 550 560 N/A INTRINSIC
DIL 634 743 6.19e-34 SMART
low complexity region 973 987 N/A INTRINSIC
PDZ 1002 1079 3.86e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Radil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Radil APN 5 142497922 missense probably damaging 0.99
IGL01359:Radil APN 5 142543713 missense probably damaging 0.98
IGL01714:Radil APN 5 142543397 unclassified probably benign
IGL02086:Radil APN 5 142543821 missense probably benign 0.28
IGL02250:Radil APN 5 142543774 missense probably damaging 1.00
IGL02296:Radil APN 5 142506463 missense probably benign 0.10
IGL02890:Radil APN 5 142543708 missense probably damaging 1.00
IGL02978:Radil APN 5 142494919 missense probably benign 0.00
IGL03131:Radil APN 5 142495342 missense probably damaging 1.00
R0362:Radil UTSW 5 142543827 missense probably benign 0.00
R0389:Radil UTSW 5 142543471 missense probably damaging 0.98
R0426:Radil UTSW 5 142497873 missense probably damaging 1.00
R1753:Radil UTSW 5 142495336 missense probably damaging 1.00
R2168:Radil UTSW 5 142506963 missense probably benign 0.00
R3055:Radil UTSW 5 142495406 missense possibly damaging 0.77
R3177:Radil UTSW 5 142506856 missense probably damaging 1.00
R3277:Radil UTSW 5 142506856 missense probably damaging 1.00
R3851:Radil UTSW 5 142506997 missense probably damaging 1.00
R4043:Radil UTSW 5 142494233 missense probably benign 0.31
R4245:Radil UTSW 5 142543791 missense probably damaging 1.00
R4367:Radil UTSW 5 142494805 missense probably benign 0.06
R4697:Radil UTSW 5 142486801 missense probably benign
R4798:Radil UTSW 5 142485163 missense probably benign 0.39
R4948:Radil UTSW 5 142485239 missense probably benign 0.02
R5407:Radil UTSW 5 142508215 missense probably damaging 1.00
R5784:Radil UTSW 5 142487513 missense possibly damaging 0.88
R5918:Radil UTSW 5 142487602 missense probably benign 0.43
R5943:Radil UTSW 5 142485458 missense probably damaging 1.00
R6112:Radil UTSW 5 142543644 missense probably damaging 1.00
R6147:Radil UTSW 5 142497940 missense probably benign 0.01
R6174:Radil UTSW 5 142487115 missense probably benign
R6241:Radil UTSW 5 142494942 missense probably damaging 1.00
R6874:Radil UTSW 5 142506802 missense probably damaging 1.00
R6881:Radil UTSW 5 142486917 missense probably benign 0.00
R7056:Radil UTSW 5 142494354 nonsense probably null
R7134:Radil UTSW 5 142485549 missense probably damaging 1.00
R7167:Radil UTSW 5 142485505 splice site probably null
R7374:Radil UTSW 5 142485480 missense probably damaging 1.00
R7482:Radil UTSW 5 142486763 missense probably benign
R7607:Radil UTSW 5 142494795 missense probably damaging 0.98
R7607:Radil UTSW 5 142506613 missense probably damaging 0.99
R7777:Radil UTSW 5 142543548 missense probably damaging 1.00
R7779:Radil UTSW 5 142487565 missense probably benign 0.03
R8123:Radil UTSW 5 142487620 missense probably damaging 0.99
R8418:Radil UTSW 5 142494921 missense probably benign 0.23
X0058:Radil UTSW 5 142487514 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCTAGGACCTGGTTGAGGAG -3'
(R):5'- CTTCTAGGTGACTGCCATGTC -3'

Sequencing Primer
(F):5'- TTGAGGAGCAGTGTGCCAG -3'
(R):5'- TGACTGCCATGTCCAGCC -3'
Posted On2020-01-23