Incidental Mutation 'R8047:D6Ertd527e'
ID618811
Institutional Source Beutler Lab
Gene Symbol D6Ertd527e
Ensembl Gene ENSMUSG00000090891
Gene NameDNA segment, Chr 6, ERATO Doi 527, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location87104746-87112997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87111472 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 206 (V206F)
Ref Sequence ENSEMBL: ENSMUSP00000145529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170124] [ENSMUST00000203747] [ENSMUST00000204927]
Predicted Effect unknown
Transcript: ENSMUST00000170124
AA Change: V205F
SMART Domains Protein: ENSMUSP00000130803
Gene: ENSMUSG00000090891
AA Change: V205F

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203747
AA Change: V205F
SMART Domains Protein: ENSMUSP00000144761
Gene: ENSMUSG00000090891
AA Change: V205F

DomainStartEndE-ValueType
low complexity region 5 182 N/A INTRINSIC
internal_repeat_1 185 206 1.04e-33 PROSPERO
low complexity region 211 242 N/A INTRINSIC
internal_repeat_2 243 253 2.12e-11 PROSPERO
internal_repeat_2 259 269 2.12e-11 PROSPERO
low complexity region 271 293 N/A INTRINSIC
internal_repeat_1 296 317 1.04e-33 PROSPERO
low complexity region 322 458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204927
AA Change: V206F
SMART Domains Protein: ENSMUSP00000145529
Gene: ENSMUSG00000090891
AA Change: V206F

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in D6Ertd527e
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bursting UTSW 6 87111317 missense unknown
sonenschein UTSW 6 87111524 missense unknown
R0325:D6Ertd527e UTSW 6 87111295 missense unknown
R0415:D6Ertd527e UTSW 6 87111524 missense unknown
R0607:D6Ertd527e UTSW 6 87111905 missense unknown
R0739:D6Ertd527e UTSW 6 87111668 missense unknown
R0992:D6Ertd527e UTSW 6 87111524 missense unknown
R0993:D6Ertd527e UTSW 6 87111524 missense unknown
R1193:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1196:D6Ertd527e UTSW 6 87111524 missense unknown
R1386:D6Ertd527e UTSW 6 87111524 missense unknown
R1413:D6Ertd527e UTSW 6 87111353 missense unknown
R1485:D6Ertd527e UTSW 6 87111085 missense unknown
R1560:D6Ertd527e UTSW 6 87111524 missense unknown
R1561:D6Ertd527e UTSW 6 87111524 missense unknown
R1568:D6Ertd527e UTSW 6 87111524 missense unknown
R2290:D6Ertd527e UTSW 6 87111545 missense unknown
R4155:D6Ertd527e UTSW 6 87111524 missense unknown
R4461:D6Ertd527e UTSW 6 87111317 missense unknown
R4836:D6Ertd527e UTSW 6 87111424 small insertion probably benign
R5102:D6Ertd527e UTSW 6 87111811 missense unknown
R5149:D6Ertd527e UTSW 6 87111524 missense unknown
R5150:D6Ertd527e UTSW 6 87111524 missense unknown
R5681:D6Ertd527e UTSW 6 87111206 missense unknown
R6250:D6Ertd527e UTSW 6 87111212 missense unknown
R6398:D6Ertd527e UTSW 6 87111524 missense unknown
R6441:D6Ertd527e UTSW 6 87111524 missense unknown
R7001:D6Ertd527e UTSW 6 87111212 missense unknown
R7142:D6Ertd527e UTSW 6 87111524 missense unknown
R7297:D6Ertd527e UTSW 6 87111524 missense unknown
R7821:D6Ertd527e UTSW 6 87110897 missense unknown
S24628:D6Ertd527e UTSW 6 87111524 missense unknown
V1662:D6Ertd527e UTSW 6 87111892 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTTGATCCAGAAGACATGTG -3'
(R):5'- GCTGCTGTTGTCATAGTTGC -3'

Sequencing Primer
(F):5'- ACAGCAGCAGCATCTCTTG -3'
(R):5'- ATAGTTGCTGATGTTGCCCC -3'
Posted On2020-01-23