Incidental Mutation 'R8047:Ncapd2'
ID618813
Institutional Source Beutler Lab
Gene Symbol Ncapd2
Ensembl Gene ENSMUSG00000038252
Gene Namenon-SMC condensin I complex, subunit D2
Synonyms2810406C15Rik, 2810465G24Rik, CNAP1, CAP-D2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125168007-125191701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125189799 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 31 (V31M)
Ref Sequence ENSEMBL: ENSMUSP00000042260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032485] [ENSMUST00000043848] [ENSMUST00000188762] [ENSMUST00000189959]
Predicted Effect probably benign
Transcript: ENSMUST00000032485
SMART Domains Protein: ENSMUSP00000032485
Gene: ENSMUSG00000030335

DomainStartEndE-ValueType
Pfam:MRP-L51 38 126 4.2e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043848
AA Change: V31M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042260
Gene: ENSMUSG00000038252
AA Change: V31M

DomainStartEndE-ValueType
Pfam:Cnd1_N 75 240 1.4e-41 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Pfam:Cnd1 1058 1224 2.5e-65 PFAM
low complexity region 1329 1345 N/A INTRINSIC
low complexity region 1357 1369 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188762
AA Change: V31M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000189959
AA Change: V31M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139445
Gene: ENSMUSG00000038252
AA Change: V31M

DomainStartEndE-ValueType
Pfam:Cnd1_N 73 162 8.3e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Ncapd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Ncapd2 APN 6 125173425 missense probably benign 0.05
IGL00960:Ncapd2 APN 6 125173848 missense probably benign
IGL01307:Ncapd2 APN 6 125168619 missense possibly damaging 0.56
IGL01612:Ncapd2 APN 6 125177872 missense probably benign 0.01
IGL01903:Ncapd2 APN 6 125177460 missense probably benign
IGL01987:Ncapd2 APN 6 125185841 splice site probably benign
IGL01998:Ncapd2 APN 6 125173115 missense probably benign 0.18
IGL01998:Ncapd2 APN 6 125169933 missense probably damaging 1.00
IGL02329:Ncapd2 APN 6 125189818 missense probably damaging 0.99
IGL02550:Ncapd2 APN 6 125177447 missense probably benign
IGL02662:Ncapd2 APN 6 125176731 missense probably damaging 1.00
IGL02817:Ncapd2 APN 6 125170914 critical splice donor site probably null
IGL03121:Ncapd2 APN 6 125173612 missense probably benign 0.00
IGL03206:Ncapd2 APN 6 125171697 missense possibly damaging 0.85
FR4548:Ncapd2 UTSW 6 125173596 critical splice donor site probably benign
PIT4305001:Ncapd2 UTSW 6 125184027 nonsense probably null
R0486:Ncapd2 UTSW 6 125184027 nonsense probably null
R0635:Ncapd2 UTSW 6 125173036 missense probably benign 0.00
R0699:Ncapd2 UTSW 6 125169880 missense probably benign
R0746:Ncapd2 UTSW 6 125174264 missense possibly damaging 0.50
R0893:Ncapd2 UTSW 6 125173482 missense probably benign
R1385:Ncapd2 UTSW 6 125173115 missense probably benign 0.18
R1513:Ncapd2 UTSW 6 125170992 missense probably damaging 1.00
R1601:Ncapd2 UTSW 6 125185772 missense probably damaging 1.00
R1698:Ncapd2 UTSW 6 125168590 missense probably null 0.39
R2030:Ncapd2 UTSW 6 125176715 missense possibly damaging 0.95
R2035:Ncapd2 UTSW 6 125184528 missense probably benign 0.17
R2359:Ncapd2 UTSW 6 125179416 unclassified probably benign
R3951:Ncapd2 UTSW 6 125186784 missense probably damaging 0.98
R3952:Ncapd2 UTSW 6 125186784 missense probably damaging 0.98
R3953:Ncapd2 UTSW 6 125170734 missense probably damaging 0.96
R4623:Ncapd2 UTSW 6 125173609 missense probably benign 0.04
R4630:Ncapd2 UTSW 6 125179233 splice site probably null
R4667:Ncapd2 UTSW 6 125184518 missense possibly damaging 0.69
R4769:Ncapd2 UTSW 6 125185745 missense probably damaging 1.00
R4936:Ncapd2 UTSW 6 125169840 missense probably benign 0.18
R5130:Ncapd2 UTSW 6 125169924 missense possibly damaging 0.90
R5465:Ncapd2 UTSW 6 125176783 missense probably damaging 0.98
R5806:Ncapd2 UTSW 6 125181154 missense probably damaging 0.98
R5823:Ncapd2 UTSW 6 125168700 missense probably benign 0.00
R5888:Ncapd2 UTSW 6 125187089 missense probably damaging 1.00
R5940:Ncapd2 UTSW 6 125168869 missense probably benign
R6198:Ncapd2 UTSW 6 125179323 nonsense probably null
R6406:Ncapd2 UTSW 6 125173878 missense probably benign
R6652:Ncapd2 UTSW 6 125186270 missense probably benign 0.13
R6959:Ncapd2 UTSW 6 125168920 missense probably benign
R6977:Ncapd2 UTSW 6 125171509 missense probably damaging 1.00
R6982:Ncapd2 UTSW 6 125176736 missense probably damaging 0.96
R7143:Ncapd2 UTSW 6 125179561 missense probably benign
R7144:Ncapd2 UTSW 6 125176670 missense probably benign 0.11
R7186:Ncapd2 UTSW 6 125186156 missense possibly damaging 0.89
R7203:Ncapd2 UTSW 6 125184328 missense possibly damaging 0.58
R7384:Ncapd2 UTSW 6 125173401 missense probably benign
R8039:Ncapd2 UTSW 6 125181026 missense probably damaging 0.98
R8048:Ncapd2 UTSW 6 125179698 nonsense probably null
R8056:Ncapd2 UTSW 6 125171043 missense probably damaging 1.00
R8097:Ncapd2 UTSW 6 125168982 missense possibly damaging 0.78
RF045:Ncapd2 UTSW 6 125179236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCCCAGGACATTTTATGCC -3'
(R):5'- GACTCAGTAGAAATGTTCTTGTCAC -3'

Sequencing Primer
(F):5'- CCAGGACATTTTATGCCATGAATTCC -3'
(R):5'- ACTTGCCCTTATCTCCAGA -3'
Posted On2020-01-23