Incidental Mutation 'R8047:Gipc3'
ID618822
Institutional Source Beutler Lab
Gene Symbol Gipc3
Ensembl Gene ENSMUSG00000034872
Gene NameGIPC PDZ domain containing family, member 3
SynonymsAhl5, Gipc3, Rgs19ip3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location81335265-81343266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81341298 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 146 (N146I)
Ref Sequence ENSEMBL: ENSMUSP00000049236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020454] [ENSMUST00000045102] [ENSMUST00000105323] [ENSMUST00000105324] [ENSMUST00000122993] [ENSMUST00000167481]
Predicted Effect probably benign
Transcript: ENSMUST00000020454
SMART Domains Protein: ENSMUSP00000020454
Gene: ENSMUSG00000020232

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
HMG 69 139 8.68e-22 SMART
coiled coil region 190 257 N/A INTRINSIC
low complexity region 266 280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045102
AA Change: N146I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049236
Gene: ENSMUSG00000034872
AA Change: N146I

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
PDZ 105 179 1.19e-7 SMART
low complexity region 224 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105323
SMART Domains Protein: ENSMUSP00000100960
Gene: ENSMUSG00000020232

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
HMG 69 139 8.68e-22 SMART
coiled coil region 190 257 N/A INTRINSIC
low complexity region 266 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105324
SMART Domains Protein: ENSMUSP00000100961
Gene: ENSMUSG00000020232

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
HMG 69 139 8.68e-22 SMART
coiled coil region 190 257 N/A INTRINSIC
low complexity region 266 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122993
SMART Domains Protein: ENSMUSP00000137861
Gene: ENSMUSG00000020232

DomainStartEndE-ValueType
Pfam:HMG_box 1 36 1.2e-7 PFAM
coiled coil region 88 155 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167481
SMART Domains Protein: ENSMUSP00000128807
Gene: ENSMUSG00000020232

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
HMG 69 139 8.68e-22 SMART
coiled coil region 190 257 N/A INTRINSIC
low complexity region 266 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the GIPC family. Studies in mice suggest that this gene is required for postnatal maturation of the hair bundle and long-term survival of hair cells and spiral ganglion in the ear. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Gipc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Gipc3 APN 10 81343134 missense probably damaging 1.00
R1848:Gipc3 UTSW 10 81341265 missense probably damaging 1.00
R1885:Gipc3 UTSW 10 81341347 missense probably benign 0.20
R1921:Gipc3 UTSW 10 81338215 missense probably damaging 0.99
R1922:Gipc3 UTSW 10 81338215 missense probably damaging 0.99
R4722:Gipc3 UTSW 10 81341295 missense probably benign 0.01
R7171:Gipc3 UTSW 10 81341621 missense probably damaging 1.00
R7993:Gipc3 UTSW 10 81337971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCATTGCAAAGCAGGCC -3'
(R):5'- GGTGATCAATGGCCTTGTCG -3'

Sequencing Primer
(F):5'- AGGCCCAAGGTCATCTTTG -3'
(R):5'- CTTGTCGAGTCCTAAGAAGACTCTG -3'
Posted On2020-01-23