Incidental Mutation 'R8047:Patz1'
ID618823
Institutional Source Beutler Lab
Gene Symbol Patz1
Ensembl Gene ENSMUSG00000020453
Gene NamePOZ (BTB) and AT hook containing zinc finger 1
SynonymsMAZR, POZ-AT hook-zinc finger protein, 8430401L15Rik, Zfp278
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location3288874-3309083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3306283 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 523 (P523L)
Ref Sequence ENSEMBL: ENSMUSP00000105670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057089] [ENSMUST00000093402] [ENSMUST00000110043] [ENSMUST00000134089] [ENSMUST00000154319]
Predicted Effect probably benign
Transcript: ENSMUST00000057089
SMART Domains Protein: ENSMUSP00000050684
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 559 582 1.98e-4 SMART
low complexity region 585 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093402
SMART Domains Protein: ENSMUSP00000091103
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110043
AA Change: P523L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105670
Gene: ENSMUSG00000020453
AA Change: P523L

DomainStartEndE-ValueType
BTB 41 160 7.97e-24 SMART
low complexity region 209 224 N/A INTRINSIC
AT_hook 264 276 1.74e-1 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
AT_hook 345 357 2.82e2 SMART
ZnF_C2H2 355 377 8.94e-3 SMART
ZnF_C2H2 383 405 5.21e-4 SMART
ZnF_C2H2 413 436 3.39e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 468 489 2.01e1 SMART
ZnF_C2H2 495 517 1.26e-2 SMART
Pfam:zf-C2H2_assoc3 536 604 6.5e-36 PFAM
ZnF_C2H2 605 628 1.98e-4 SMART
low complexity region 631 644 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134089
SMART Domains Protein: ENSMUSP00000138522
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 5 29 2.82e0 SMART
ZnF_C2H2 33 54 2.01e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154319
SMART Domains Protein: ENSMUSP00000122832
Gene: ENSMUSG00000020453

DomainStartEndE-ValueType
ZnF_C2H2 6 25 5.68e1 SMART
ZnF_C2H2 29 50 2.01e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an A-T hook DNA binding motif which usually binds to other DNA binding structures to play an important role in chromatin modeling and transcription regulation. Its Poz domain is thought to function as a site for protein-protein interaction and is required for transcriptional repression, and the zinc-fingers comprise the DNA binding domain. Since the encoded protein has typical features of a transcription factor, it is postulated to be a repressor of gene expression. In small round cell sarcoma, this gene is fused to EWS by a small inversion of 22q, then the hybrid is thought to be translocated (t(1;22)(p36.1;q12). The rearrangement of chromosome 22 involves intron 8 of EWS and exon 1 of this gene creating a chimeric sequence containing the transactivation domain of EWS fused to zinc finger domain of this protein. This is a distinct example of an intra-chromosomal rearrangement of chromosome 22. Four alternatively spliced transcript variants are described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic and fetal lethality, exencephaly, nervous system defects, outflow defects, transposition of great arteries, postnatal growth retardation and male and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Patz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Patz1 APN 11 3291134 missense probably damaging 1.00
IGL02954:Patz1 APN 11 3291761 missense probably damaging 1.00
IGL02981:Patz1 APN 11 3290656 missense probably damaging 1.00
R0153:Patz1 UTSW 11 3293288 missense probably damaging 1.00
R0758:Patz1 UTSW 11 3290879 missense probably damaging 1.00
R1680:Patz1 UTSW 11 3307812 missense probably damaging 0.96
R1954:Patz1 UTSW 11 3291088 missense probably damaging 0.99
R4610:Patz1 UTSW 11 3306241 missense probably damaging 1.00
R4964:Patz1 UTSW 11 3307720 missense probably damaging 1.00
R5832:Patz1 UTSW 11 3306277 missense probably benign 0.00
R7172:Patz1 UTSW 11 3308032 missense probably benign
R7454:Patz1 UTSW 11 3298297 start gained probably benign
R8026:Patz1 UTSW 11 3307658 missense probably benign 0.00
Z1177:Patz1 UTSW 11 3291751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCTCATGTGATGATTGC -3'
(R):5'- TAGAGAGCACTGCGATTCTTG -3'

Sequencing Primer
(F):5'- GCAGATGCTTTTGAGCCAAG -3'
(R):5'- GCACTGCGATTCTTGCCTCC -3'
Posted On2020-01-23