Incidental Mutation 'R8047:Engase'
ID618825
Institutional Source Beutler Lab
Gene Symbol Engase
Ensembl Gene ENSMUSG00000033857
Gene Nameendo-beta-N-acetylglucosaminidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location118476829-118489209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118486456 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 526 (S526P)
Ref Sequence ENSEMBL: ENSMUSP00000117538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017576] [ENSMUST00000043447] [ENSMUST00000069343] [ENSMUST00000103023] [ENSMUST00000106278] [ENSMUST00000117731] [ENSMUST00000135383] [ENSMUST00000139917] [ENSMUST00000166995] [ENSMUST00000168689] [ENSMUST00000171769]
Predicted Effect probably benign
Transcript: ENSMUST00000017576
SMART Domains Protein: ENSMUSP00000017576
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 208 269 1e-22 PFAM
Pfam:Fox-1_C 279 345 3.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043447
Predicted Effect probably benign
Transcript: ENSMUST00000069343
SMART Domains Protein: ENSMUSP00000069598
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 165 8.3e-2 SMART
Pfam:Fox-1_C 176 229 4.1e-15 PFAM
Pfam:Fox-1_C 226 314 4.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103023
SMART Domains Protein: ENSMUSP00000099312
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106278
SMART Domains Protein: ENSMUSP00000101885
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117731
SMART Domains Protein: ENSMUSP00000113636
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 260 3.5e-15 PFAM
Pfam:Fox-1_C 257 345 4.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135383
AA Change: S526P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117538
Gene: ENSMUSG00000033857
AA Change: S526P

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Glyco_hydro_85 127 404 2.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139917
SMART Domains Protein: ENSMUSP00000129698
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166995
SMART Domains Protein: ENSMUSP00000127862
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168689
AA Change: S165P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125886
Gene: ENSMUSG00000033857
AA Change: S165P

DomainStartEndE-ValueType
PDB:3FHA|D 13 143 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171769
SMART Domains Protein: ENSMUSP00000132734
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme which catalyzes the hydrolysis of peptides and proteins with mannose modifications to produce free oligosaccharides. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozgyous for knock-out alleles of this gene and Ngly1 exhibit restored endoplasmic reticulum (ER)-associated degradation (ERAD) process compared with MEFs lacking only Ngly1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Engase
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Engase APN 11 118482970 missense possibly damaging 0.91
IGL00963:Engase APN 11 118482998 missense probably damaging 1.00
IGL02652:Engase APN 11 118478950 missense probably damaging 0.99
R0135:Engase UTSW 11 118484478 missense possibly damaging 0.68
R1337:Engase UTSW 11 118482574 missense possibly damaging 0.46
R1435:Engase UTSW 11 118484901 missense probably damaging 1.00
R1515:Engase UTSW 11 118487140 missense possibly damaging 0.53
R1889:Engase UTSW 11 118478933 missense probably damaging 1.00
R1939:Engase UTSW 11 118479186 missense probably damaging 1.00
R4628:Engase UTSW 11 118484905 missense probably damaging 1.00
R4730:Engase UTSW 11 118482922 missense probably damaging 1.00
R4762:Engase UTSW 11 118487094 missense possibly damaging 0.89
R4775:Engase UTSW 11 118482671 missense probably benign 0.22
R5155:Engase UTSW 11 118481281 missense probably benign 0.25
R5271:Engase UTSW 11 118481397 missense probably damaging 0.99
R5688:Engase UTSW 11 118487320 missense possibly damaging 0.91
R6659:Engase UTSW 11 118481316 missense probably benign 0.07
R7104:Engase UTSW 11 118481295 missense probably damaging 0.98
R7233:Engase UTSW 11 118483001 missense probably damaging 1.00
R7961:Engase UTSW 11 118486860 missense possibly damaging 0.67
Z1177:Engase UTSW 11 118485757 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGGGATCTTACCTAGACACCC -3'
(R):5'- GGAGTGTCCTTGTCTCACTC -3'

Sequencing Primer
(F):5'- GATCTTACCTAGACACCCACCCC -3'
(R):5'- CTCTTCTAGGATTTCTCAGTGCAGAC -3'
Posted On2020-01-23