Incidental Mutation 'R8047:Ston2'
ID618827
Institutional Source Beutler Lab
Gene Symbol Ston2
Ensembl Gene ENSMUSG00000020961
Gene Namestonin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location91633009-91788387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91641843 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 828 (V828I)
Ref Sequence ENSEMBL: ENSMUSP00000053908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052969] [ENSMUST00000164713]
Predicted Effect probably damaging
Transcript: ENSMUST00000052969
AA Change: V828I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053908
Gene: ENSMUSG00000020961
AA Change: V828I

DomainStartEndE-ValueType
Pfam:Stonin2_N 1 337 3e-228 PFAM
Pfam:Adap_comp_sub 554 873 7.3e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164713
AA Change: V828I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131098
Gene: ENSMUSG00000020961
AA Change: V828I

DomainStartEndE-ValueType
Pfam:Stonin2_N 1 337 1.3e-181 PFAM
Pfam:Adap_comp_sub 554 872 1.9e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a membrane protein involved in regulating endocytotic complexes. The protein product is described as one of the clathrin-associated sorting proteins, adaptor molecules which ensure specific proteins are internalized. The encoded protein has also been shown to participate in synaptic vesicle recycling through interaction with synaptotagmin 1 required for neurotransmission. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit compromised endocytic synaptic vesicle sorting fidelity, hyperactivity and abnormal response to novel object. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Ston2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ston2 APN 12 91648748 missense possibly damaging 0.67
IGL02102:Ston2 APN 12 91639724 makesense probably null
IGL03177:Ston2 APN 12 91647657 missense probably damaging 1.00
IGL03233:Ston2 APN 12 91647853 missense probably damaging 1.00
PIT4305001:Ston2 UTSW 12 91648502 missense possibly damaging 0.90
R0158:Ston2 UTSW 12 91740602 missense probably damaging 1.00
R0365:Ston2 UTSW 12 91647860 missense probably benign 0.00
R0671:Ston2 UTSW 12 91740466 splice site probably null
R1005:Ston2 UTSW 12 91648848 missense possibly damaging 0.56
R1381:Ston2 UTSW 12 91740492 missense probably damaging 0.97
R1507:Ston2 UTSW 12 91641680 missense probably benign 0.02
R1737:Ston2 UTSW 12 91647907 missense probably damaging 1.00
R4029:Ston2 UTSW 12 91648263 missense possibly damaging 0.59
R4030:Ston2 UTSW 12 91648263 missense possibly damaging 0.59
R4552:Ston2 UTSW 12 91641872 missense probably damaging 1.00
R4569:Ston2 UTSW 12 91639722 makesense probably null
R4864:Ston2 UTSW 12 91648674 missense possibly damaging 0.91
R6278:Ston2 UTSW 12 91648330 missense probably damaging 1.00
R6637:Ston2 UTSW 12 91714112 missense probably damaging 0.97
R6679:Ston2 UTSW 12 91648096 missense probably damaging 1.00
R7142:Ston2 UTSW 12 91647235 missense probably damaging 1.00
R8093:Ston2 UTSW 12 91743686 missense probably damaging 0.97
R8259:Ston2 UTSW 12 91641680 missense probably benign 0.02
R8349:Ston2 UTSW 12 91641875 missense probably damaging 1.00
R8431:Ston2 UTSW 12 91648297 missense probably damaging 1.00
R8449:Ston2 UTSW 12 91641875 missense probably damaging 1.00
X0064:Ston2 UTSW 12 91648905 missense possibly damaging 0.95
Z1088:Ston2 UTSW 12 91649067 missense possibly damaging 0.93
Z1177:Ston2 UTSW 12 91740630 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAAATGGGCTTGGACACCTC -3'
(R):5'- CTCTCAGAGCCTGATGTCTG -3'

Sequencing Primer
(F):5'- TTGGACACCTCAGCGGGAAG -3'
(R):5'- TGATTGGACCCTCAGCAAG -3'
Posted On2020-01-23