Incidental Mutation 'R8047:Eef1e1'
ID618829
Institutional Source Beutler Lab
Gene Symbol Eef1e1
Ensembl Gene ENSMUSG00000001707
Gene Nameeukaryotic translation elongation factor 1 epsilon 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location38644207-38659058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38646246 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 150 (Q150R)
Ref Sequence ENSEMBL: ENSMUSP00000001757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001757]
Predicted Effect probably damaging
Transcript: ENSMUST00000001757
AA Change: Q150R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001757
Gene: ENSMUSG00000001707
AA Change: Q150R

DomainStartEndE-ValueType
Pfam:GST_C_2 54 158 7.5e-8 PFAM
Pfam:GST_C_3 64 151 6.1e-10 PFAM
Pfam:GST_C 83 153 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, the encoded protein is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. However, its mouse homolog has been shown to translocate to the nucleus in response to DNA damage, and it plays a positive role in ATM/ATR-mediated p53 activation. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream MUTED (muted homolog) gene. An EEF1E1-related pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display early embryonic lethality while heterozygous mice exhibit prenatal semi-lethality and a significantly increased incidence of spontaneous tumorigenesis after 15 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Eef1e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Eef1e1 APN 13 38656036 splice site probably benign
PIT4431001:Eef1e1 UTSW 13 38658962 missense probably damaging 1.00
R0183:Eef1e1 UTSW 13 38656186 missense probably damaging 1.00
R1120:Eef1e1 UTSW 13 38658934 missense probably damaging 0.98
R1458:Eef1e1 UTSW 13 38656123 missense probably damaging 1.00
R1652:Eef1e1 UTSW 13 38656105 missense possibly damaging 0.90
R3841:Eef1e1 UTSW 13 38656191 missense probably damaging 1.00
R5779:Eef1e1 UTSW 13 38646273 missense probably damaging 0.96
R8324:Eef1e1 UTSW 13 38655069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACGAAGCCTCAACTACAGG -3'
(R):5'- CACAACTGTCTGCAGCTTTC -3'

Sequencing Primer
(F):5'- GCCTCAACTACAGGACAAATAAAAC -3'
(R):5'- AACTGTCTGCAGCTTTCACTTCAG -3'
Posted On2020-01-23