Incidental Mutation 'R8047:Vmn2r89'
ID618831
Institutional Source Beutler Lab
Gene Symbol Vmn2r89
Ensembl Gene ENSMUSG00000070448
Gene Namevomeronasal 2, receptor 89
SynonymsV2r10, V2r11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location51451962-51461293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51455092 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 117 (D117E)
Ref Sequence ENSEMBL: ENSMUSP00000124065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159611] [ENSMUST00000159734] [ENSMUST00000161670] [ENSMUST00000162998]
Predicted Effect probably benign
Transcript: ENSMUST00000159611
AA Change: D117E

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124065
Gene: ENSMUSG00000070448
AA Change: D117E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 449 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159734
AA Change: D117E

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124256
Gene: ENSMUSG00000070448
AA Change: D117E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 420 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161670
SMART Domains Protein: ENSMUSP00000124261
Gene: ENSMUSG00000070448

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Vmn2r89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Vmn2r89 APN 14 51454965 missense probably damaging 1.00
IGL00990:Vmn2r89 APN 14 51455971 missense probably benign 0.14
IGL00990:Vmn2r89 APN 14 51457493 missense probably benign
IGL01991:Vmn2r89 APN 14 51452219 missense probably benign 0.00
IGL03073:Vmn2r89 APN 14 51456071 missense possibly damaging 0.95
IGL03085:Vmn2r89 APN 14 51452158 missense probably damaging 0.99
IGL03278:Vmn2r89 APN 14 51455100 missense probably damaging 0.99
R0115:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0127:Vmn2r89 UTSW 14 51455703 missense probably damaging 0.98
R0391:Vmn2r89 UTSW 14 51455978 missense probably damaging 0.99
R0481:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0538:Vmn2r89 UTSW 14 51457591 splice site probably null
R1210:Vmn2r89 UTSW 14 51454970 missense probably benign 0.01
R1332:Vmn2r89 UTSW 14 51455102 missense probably benign 0.00
R1660:Vmn2r89 UTSW 14 51456236 missense possibly damaging 0.48
R1959:Vmn2r89 UTSW 14 51457440 missense probably benign 0.22
R2876:Vmn2r89 UTSW 14 51455084 missense possibly damaging 0.47
R3410:Vmn2r89 UTSW 14 51456171 missense probably damaging 0.98
R4026:Vmn2r89 UTSW 14 51452043 start codon destroyed probably null 1.00
R4398:Vmn2r89 UTSW 14 51452094 missense probably damaging 1.00
R4700:Vmn2r89 UTSW 14 51457485 missense probably damaging 1.00
R4714:Vmn2r89 UTSW 14 51452231 missense probably damaging 0.97
R5162:Vmn2r89 UTSW 14 51456163 missense possibly damaging 0.88
R5294:Vmn2r89 UTSW 14 51455113 missense probably benign 0.00
R5811:Vmn2r89 UTSW 14 51456108 missense probably benign 0.12
R6087:Vmn2r89 UTSW 14 51457576 splice site probably null
R6229:Vmn2r89 UTSW 14 51455721 missense probably benign 0.05
R6246:Vmn2r89 UTSW 14 51456046 missense probably damaging 1.00
R6572:Vmn2r89 UTSW 14 51455993 missense probably damaging 1.00
R7351:Vmn2r89 UTSW 14 51456282 missense probably benign 0.30
R7683:Vmn2r89 UTSW 14 51455194 missense probably benign
R7974:Vmn2r89 UTSW 14 51456002 missense probably damaging 1.00
R8093:Vmn2r89 UTSW 14 51456242 missense probably benign 0.00
X0019:Vmn2r89 UTSW 14 51456415 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AATCTAGTTCAAGGATGGCATTGAG -3'
(R):5'- GTTGTTAACCCATTCAGTGTCAC -3'

Sequencing Primer
(F):5'- TTCAAGGATGGCATTGAGATAAAAC -3'
(R):5'- AGTGTCACATGTTCTTACCATTGG -3'
Posted On2020-01-23