Incidental Mutation 'R8047:Msra'
ID618832
Institutional Source Beutler Lab
Gene Symbol Msra
Ensembl Gene ENSMUSG00000054733
Gene Namemethionine sulfoxide reductase A
Synonyms2310045J23Rik, MSR-A, 6530413P12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location64122625-64455903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64285163 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 76 (A76T)
Ref Sequence ENSEMBL: ENSMUSP00000065754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067927] [ENSMUST00000210363] [ENSMUST00000210428]
PDB Structure
Solution structure of murine myristoylated msrA [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000067927
AA Change: A76T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065754
Gene: ENSMUSG00000054733
AA Change: A76T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:PMSR 65 219 2.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210363
AA Change: A12T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210428
AA Change: A34T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this allele display an increased sensitivity to oxidative stress, reductions in related enzyme levels, and reduced life spans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tiam1 A G 16: 89,897,784 S262P probably benign Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Msra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Msra APN 14 64123325 missense probably damaging 0.99
IGL01301:Msra APN 14 64210435 missense probably damaging 1.00
IGL02500:Msra APN 14 64285188 splice site probably benign
IGL03227:Msra APN 14 64313743 missense probably benign 0.06
ANU18:Msra UTSW 14 64210435 missense probably damaging 1.00
R0485:Msra UTSW 14 64440761 missense possibly damaging 0.64
R0632:Msra UTSW 14 64210532 missense probably benign 0.04
R1557:Msra UTSW 14 64123326 missense possibly damaging 0.75
R1940:Msra UTSW 14 64285056 splice site probably benign
R2133:Msra UTSW 14 64233928 missense probably damaging 1.00
R2135:Msra UTSW 14 64123208 missense probably damaging 1.00
R6119:Msra UTSW 14 64440734 missense probably damaging 1.00
R6602:Msra UTSW 14 64123339 missense probably benign 0.01
R7233:Msra UTSW 14 64123265 missense probably damaging 1.00
R7249:Msra UTSW 14 64440763 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATGGGAAGCTCATCAACCTC -3'
(R):5'- GCTGGAACTAAATCATTCTTCAGC -3'

Sequencing Primer
(F):5'- TGGGAAGCTCATCAACCTCTACAG -3'
(R):5'- CATTCTTCAGCATTAAAACCTTGC -3'
Posted On2020-01-23