Incidental Mutation 'R8047:Tiam1'
ID618838
Institutional Source Beutler Lab
Gene Symbol Tiam1
Ensembl Gene ENSMUSG00000002489
Gene NameT cell lymphoma invasion and metastasis 1
SynonymsD16Ium10e, D16Ium10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8047 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location89787111-90143769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89897784 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 262 (S262P)
Ref Sequence ENSEMBL: ENSMUSP00000002588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002588] [ENSMUST00000114124] [ENSMUST00000163370]
Predicted Effect probably benign
Transcript: ENSMUST00000002588
AA Change: S262P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000002588
Gene: ENSMUSG00000002489
AA Change: S262P

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000114124
AA Change: S262P
SMART Domains Protein: ENSMUSP00000109759
Gene: ENSMUSG00000002489
AA Change: S262P

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163370
AA Change: S262P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132137
Gene: ENSMUSG00000002489
AA Change: S262P

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele display resistance to chemically-induced tumors, however, tumors that do develop progress to malignancy. Mice homozygous for a gene trap allele display anencephaly, exencephaly and/or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,180,529 T233M possibly damaging Het
4930402H24Rik A T 2: 130,775,099 V439E probably damaging Het
Abce1 G A 8: 79,701,188 T157I possibly damaging Het
Cdh22 G A 2: 165,170,767 R133W probably damaging Het
Cep152 A T 2: 125,564,327 N1428K probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Coch G A 12: 51,603,713 probably null Het
D6Ertd527e G T 6: 87,111,472 V206F unknown Het
Dock3 T C 9: 106,993,009 I625M possibly damaging Het
Dpy19l4 A G 4: 11,317,139 S20P probably benign Het
Eef1e1 T C 13: 38,646,246 Q150R probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Engase T C 11: 118,486,456 S526P probably benign Het
Fbxo40 T A 16: 36,969,869 D293V probably damaging Het
Gipc3 T A 10: 81,341,298 N146I probably damaging Het
Gm11569 T C 11: 99,798,790 T28A unknown Het
Gm17783 T C 16: 45,520,466 I245V probably benign Het
Gm43302 T C 5: 105,274,757 I470V possibly damaging Het
Gpihbp1 A G 15: 75,597,778 Q114R possibly damaging Het
Grhl2 T A 15: 37,336,221 M454K probably benign Het
Gsap A T 5: 21,257,868 probably null Het
Ighv6-5 T C 12: 114,416,571 probably null Het
Kif1b C A 4: 149,214,922 V1010L probably damaging Het
Krt8 A T 15: 102,003,971 I90N probably damaging Het
Lrrc69 A T 4: 14,773,726 I110N probably benign Het
Lta T C 17: 35,204,035 Y104C probably damaging Het
Madd A G 2: 91,179,201 Y13H probably damaging Het
Mccc2 C T 13: 99,954,673 V439I probably benign Het
Mecom T A 3: 30,238,255 D35V Het
Msra C T 14: 64,285,163 A76T probably damaging Het
Myo18b G T 5: 112,723,815 D2133E possibly damaging Het
Ncapd2 C T 6: 125,189,799 V31M probably damaging Het
Npc1 A G 18: 12,213,317 V274A probably benign Het
Olfr1029 T C 2: 85,975,927 I228T possibly damaging Het
Patz1 C T 11: 3,306,283 P523L probably benign Het
Pbx2 T C 17: 34,595,288 S350P probably benign Het
Plk4 T C 3: 40,805,752 I361T probably benign Het
Ppat G T 5: 76,925,710 N122K probably damaging Het
Prss23 T A 7: 89,509,928 Q311L probably damaging Het
Psg26 G T 7: 18,478,549 Q294K possibly damaging Het
Rab3il1 G T 19: 10,033,802 R285L probably benign Het
Radil A G 5: 142,494,940 C587R probably damaging Het
Rd3 A T 1: 191,977,659 probably benign Het
Reck T C 4: 43,927,221 L504P probably damaging Het
Selenov A C 7: 28,290,683 L132R probably benign Het
Spag16 A T 1: 69,842,996 D49V probably damaging Het
Ston2 C T 12: 91,641,843 V828I probably damaging Het
Tlnrd1 A T 7: 83,882,861 S121T probably damaging Het
Unc13c T A 9: 73,812,354 K1011* probably null Het
Vmn2r89 T A 14: 51,455,092 D117E probably benign Het
Zbtb7c A C 18: 76,137,150 N103T probably damaging Het
Zfp764 T C 7: 127,406,240 E75G probably damaging Het
Other mutations in Tiam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tiam1 APN 16 89794739 missense probably damaging 1.00
IGL01356:Tiam1 APN 16 89837788 missense probably damaging 0.99
IGL01583:Tiam1 APN 16 89789280 missense probably damaging 1.00
IGL01626:Tiam1 APN 16 89812968 missense probably damaging 1.00
IGL01802:Tiam1 APN 16 89898372 missense possibly damaging 0.94
IGL01818:Tiam1 APN 16 89867704 missense probably damaging 1.00
IGL02146:Tiam1 APN 16 89849681 missense probably benign 0.20
IGL02329:Tiam1 APN 16 89800036 missense probably benign 0.08
IGL02341:Tiam1 APN 16 89898369 missense probably damaging 1.00
IGL02622:Tiam1 APN 16 89798700 missense possibly damaging 0.59
F5770:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
PIT4515001:Tiam1 UTSW 16 89860242 missense probably damaging 0.99
R0130:Tiam1 UTSW 16 89897754 missense probably benign 0.01
R0143:Tiam1 UTSW 16 89898200 missense probably benign 0.01
R0158:Tiam1 UTSW 16 89793001 critical splice donor site probably benign
R0413:Tiam1 UTSW 16 89809365 splice site probably benign
R0449:Tiam1 UTSW 16 89837827 missense possibly damaging 0.75
R0520:Tiam1 UTSW 16 89817951 splice site probably benign
R0667:Tiam1 UTSW 16 89897984 missense probably damaging 1.00
R0787:Tiam1 UTSW 16 89789561 missense probably damaging 1.00
R1355:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1370:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1534:Tiam1 UTSW 16 89867508 critical splice donor site probably null
R1769:Tiam1 UTSW 16 89860279 missense probably damaging 1.00
R1831:Tiam1 UTSW 16 89860294 missense probably benign 0.01
R1913:Tiam1 UTSW 16 89798694 missense probably damaging 1.00
R2022:Tiam1 UTSW 16 89877187 missense probably benign
R2140:Tiam1 UTSW 16 89849645 splice site probably benign
R2383:Tiam1 UTSW 16 89798684 missense probably benign 0.29
R2697:Tiam1 UTSW 16 89793164 missense probably benign 0.00
R4118:Tiam1 UTSW 16 89877033 splice site probably null
R4327:Tiam1 UTSW 16 89855891 missense possibly damaging 0.80
R4693:Tiam1 UTSW 16 89843282 missense possibly damaging 0.87
R5104:Tiam1 UTSW 16 89818041 missense probably benign 0.00
R5412:Tiam1 UTSW 16 89884865 missense possibly damaging 0.52
R5426:Tiam1 UTSW 16 89865392 missense possibly damaging 0.58
R5600:Tiam1 UTSW 16 89865365 missense probably damaging 1.00
R5842:Tiam1 UTSW 16 89855999 missense probably benign
R5986:Tiam1 UTSW 16 89789186 missense probably benign 0.31
R6077:Tiam1 UTSW 16 89798030 critical splice donor site probably null
R6419:Tiam1 UTSW 16 89898024 nonsense probably null
R6525:Tiam1 UTSW 16 89858597 critical splice donor site probably null
R6950:Tiam1 UTSW 16 89860204 critical splice donor site probably null
R7127:Tiam1 UTSW 16 89860260 missense probably damaging 1.00
R7197:Tiam1 UTSW 16 89884938 missense probably damaging 1.00
R7249:Tiam1 UTSW 16 89843255 missense probably damaging 1.00
R7490:Tiam1 UTSW 16 89898195 missense probably benign 0.01
R7825:Tiam1 UTSW 16 89898089 missense probably benign 0.07
R8069:Tiam1 UTSW 16 89789258 missense probably benign
R8247:Tiam1 UTSW 16 89898149 missense probably benign 0.26
V7582:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
Z1176:Tiam1 UTSW 16 89865275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCACTTTAAGAGGCGCGC -3'
(R):5'- AAATCTTGGGTTCCGCGGAAG -3'

Sequencing Primer
(F):5'- ACTGAAACATCTCTGAGGCTTTACC -3'
(R):5'- TTCCGCGGAAGAGAAGGATTG -3'
Posted On2020-01-23