Incidental Mutation 'R8048:Zc3h6'
ID618856
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Namezinc finger CCCH type containing 6
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R8048 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location128967402-129018563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129017014 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 988 (S988R)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
Predicted Effect probably benign
Transcript: ENSMUST00000110320
AA Change: S988R

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: S988R

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,410,844 L318F probably damaging Het
Alms1 T A 6: 85,641,334 S2318R probably benign Het
Arhgap12 G A 18: 6,052,883 T443I probably benign Het
Arhgap29 C T 3: 121,992,901 R372W probably damaging Het
Astn1 T C 1: 158,688,638 I1266T probably benign Het
Bsg T C 10: 79,709,746 V164A probably benign Het
C1qa G T 4: 136,896,610 S94R probably benign Het
Cadps2 A G 6: 23,838,863 V92A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc187 T A 2: 26,293,514 D158V possibly damaging Het
Cngb1 T A 8: 95,263,210 Y758F possibly damaging Het
Ddx4 G A 13: 112,622,172 A285V probably null Het
Dsg1c A T 18: 20,274,767 K390M probably damaging Het
Dst T C 1: 34,190,636 F2437L probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam227a CATTGTCTTGA CA 15: 79,649,758 probably null Het
Fez2 T C 17: 78,387,053 I303V probably benign Het
Ffar1 A T 7: 30,860,578 I298N probably benign Het
Hpx C T 7: 105,595,478 V228I probably benign Het
Igkv1-117 T G 6: 68,121,802 C112G probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Ivl T A 3: 92,571,924 K278M probably damaging Het
Lyst A G 13: 13,687,645 T2589A probably benign Het
Madd A T 2: 91,154,448 M1359K probably damaging Het
Nav3 T C 10: 109,764,918 T1283A probably benign Het
Ncapd2 G T 6: 125,179,698 C439* probably null Het
Nebl T C 2: 17,424,522 D266G probably benign Het
Oas1f G T 5: 120,847,537 G49V probably damaging Het
Oas1f A T 5: 120,848,416 Q144L possibly damaging Het
Olfr1032 T G 2: 86,008,180 S135A probably damaging Het
Olfr1052 C T 2: 86,298,328 P171S probably benign Het
Olfr1062 T A 2: 86,423,307 Y123F probably damaging Het
Olfr134 T C 17: 38,175,528 V148A probably benign Het
Olfr141 T A 2: 86,806,171 Y276F probably damaging Het
Olfr1440 A G 19: 12,394,355 I31V not run Het
Olfr324 A G 11: 58,597,407 I6V unknown Het
Olfr711 C T 7: 106,972,464 probably benign Het
Olfr740 T C 14: 50,453,916 L288P possibly damaging Het
Olfr917 C T 9: 38,665,812 E11K probably benign Het
Pard3b T A 1: 62,153,989 V217E probably damaging Het
Pcdha2 T A 18: 36,939,460 I48N probably damaging Het
Pi4ka A G 16: 17,303,127 F1248L Het
Plpp4 C T 7: 129,379,477 R151C unknown Het
Pramef17 T A 4: 143,991,607 Y422F probably benign Het
Prdm16 A G 4: 154,320,882 L1245P probably damaging Het
Prob1 G A 18: 35,653,551 A550V probably benign Het
Prok1 T C 3: 107,237,092 H65R probably benign Het
Ptcd1 A G 5: 145,155,077 V404A probably benign Het
Sbf2 T C 7: 110,315,082 E1631G probably benign Het
Sdad1 C A 5: 92,300,089 K262N probably benign Het
Sh3bp1 G T 15: 78,910,072 A547S probably benign Het
Sptb T C 12: 76,628,559 D227G probably benign Het
Tbx1 A G 16: 18,588,019 M1T probably null Het
Tespa1 T A 10: 130,347,339 V51D probably damaging Het
Tmc7 T C 7: 118,566,245 N82S probably benign Het
Tmem8b A G 4: 43,689,476 D290G possibly damaging Het
Trbv13-2 A T 6: 41,121,559 T23S probably damaging Het
Trib3 A T 2: 152,338,633 D213E probably damaging Het
Tubgcp4 T C 2: 121,183,500 V178A probably benign Het
Virma T A 4: 11,539,918 C1412* probably null Het
Vmn2r108 T C 17: 20,471,500 T254A probably benign Het
Vps13d A G 4: 145,155,567 V1152A Het
Wdr47 T C 3: 108,618,968 V269A probably damaging Het
Zc3h13 T A 14: 75,324,537 D676E unknown Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 unclassified probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCTTGATCCAACATCAGC -3'
(R):5'- GCTCCATTGCAGATAACGAAC -3'

Sequencing Primer
(F):5'- TTGATCCAACATCAGCAGCCAAAG -3'
(R):5'- TGCAGATAACGAACCTTTATCCCTAG -3'
Posted On2020-01-23