Incidental Mutation 'R8048:Eln'
ID618871
Institutional Source Beutler Lab
Gene Symbol Eln
Ensembl Gene ENSMUSG00000029675
Gene Nameelastin
SynonymsE030024M20Rik, tropoelastin
Accession Numbers

Ncbi RefSeq: NM_007925.3; MGI:95317

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8048 (G1)
Quality Score217.468
Status Not validated
Chromosome5
Chromosomal Location134702593-134747323 bp(-) (GRCm38)
Type of Mutationsmall deletion (4 aa in frame mutation)
DNA Base Change (assembly) CTCCAGCTCCGAT to C at 134729149 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015138] [ENSMUST00000201856]
Predicted Effect probably benign
Transcript: ENSMUST00000015138
SMART Domains Protein: ENSMUSP00000015138
Gene: ENSMUSG00000029675

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
low complexity region 224 264 N/A INTRINSIC
low complexity region 292 301 N/A INTRINSIC
low complexity region 312 446 N/A INTRINSIC
low complexity region 451 798 N/A INTRINSIC
low complexity region 818 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201856
SMART Domains Protein: ENSMUSP00000144555
Gene: ENSMUSG00000029675

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
SCOP:d1iq0a2 227 280 8e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 2153007
Lethality: 3- 4
FUNCTION: This gene encodes elastin, the extracellular matrix protein that forms a major structural component of several tissues including lungs and arterial walls. Cleavage of the signal peptide from the encoded precursor generates soluble tropoelastin which undergoes lysine-derived crosslinking to form elastin polymers. Mice lacking the encoded protein exhibit defective lung development, and die of an obstructive arterial disease resulting from subendothelial cell proliferation and reorganization of smooth muscle. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for null allele die in the early postnatal period of an obstructive arterial disease. They exhibit a decrease in arterial diameter due to subendothelial accumulation of arterial smooth muscle, and display defective terminal airway development resulting in emphysematous morphology. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,410,844 L318F probably damaging Het
Alms1 T A 6: 85,641,334 S2318R probably benign Het
Arhgap12 G A 18: 6,052,883 T443I probably benign Het
Arhgap29 C T 3: 121,992,901 R372W probably damaging Het
Astn1 T C 1: 158,688,638 I1266T probably benign Het
Bsg T C 10: 79,709,746 V164A probably benign Het
C1qa G T 4: 136,896,610 S94R probably benign Het
Cadps2 A G 6: 23,838,863 V92A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc187 T A 2: 26,293,514 D158V possibly damaging Het
Cngb1 T A 8: 95,263,210 Y758F possibly damaging Het
Ddx4 G A 13: 112,622,172 A285V probably null Het
Dsg1c A T 18: 20,274,767 K390M probably damaging Het
Dst T C 1: 34,190,636 F2437L probably benign Het
Fam227a CATTGTCTTGA CA 15: 79,649,758 probably null Het
Fez2 T C 17: 78,387,053 I303V probably benign Het
Ffar1 A T 7: 30,860,578 I298N probably benign Het
Hpx C T 7: 105,595,478 V228I probably benign Het
Igkv1-117 T G 6: 68,121,802 C112G probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Ivl T A 3: 92,571,924 K278M probably damaging Het
Lyst A G 13: 13,687,645 T2589A probably benign Het
Madd A T 2: 91,154,448 M1359K probably damaging Het
Nav3 T C 10: 109,764,918 T1283A probably benign Het
Ncapd2 G T 6: 125,179,698 C439* probably null Het
Nebl T C 2: 17,424,522 D266G probably benign Het
Oas1f G T 5: 120,847,537 G49V probably damaging Het
Oas1f A T 5: 120,848,416 Q144L possibly damaging Het
Olfr1032 T G 2: 86,008,180 S135A probably damaging Het
Olfr1052 C T 2: 86,298,328 P171S probably benign Het
Olfr1062 T A 2: 86,423,307 Y123F probably damaging Het
Olfr134 T C 17: 38,175,528 V148A probably benign Het
Olfr141 T A 2: 86,806,171 Y276F probably damaging Het
Olfr1440 A G 19: 12,394,355 I31V not run Het
Olfr324 A G 11: 58,597,407 I6V unknown Het
Olfr711 C T 7: 106,972,464 probably benign Het
Olfr740 T C 14: 50,453,916 L288P possibly damaging Het
Olfr917 C T 9: 38,665,812 E11K probably benign Het
Pard3b T A 1: 62,153,989 V217E probably damaging Het
Pcdha2 T A 18: 36,939,460 I48N probably damaging Het
Pi4ka A G 16: 17,303,127 F1248L Het
Plpp4 C T 7: 129,379,477 R151C unknown Het
Pramef17 T A 4: 143,991,607 Y422F probably benign Het
Prdm16 A G 4: 154,320,882 L1245P probably damaging Het
Prob1 G A 18: 35,653,551 A550V probably benign Het
Prok1 T C 3: 107,237,092 H65R probably benign Het
Ptcd1 A G 5: 145,155,077 V404A probably benign Het
Sbf2 T C 7: 110,315,082 E1631G probably benign Het
Sdad1 C A 5: 92,300,089 K262N probably benign Het
Sh3bp1 G T 15: 78,910,072 A547S probably benign Het
Sptb T C 12: 76,628,559 D227G probably benign Het
Tbx1 A G 16: 18,588,019 M1T probably null Het
Tespa1 T A 10: 130,347,339 V51D probably damaging Het
Tmc7 T C 7: 118,566,245 N82S probably benign Het
Tmem8b A G 4: 43,689,476 D290G possibly damaging Het
Trbv13-2 A T 6: 41,121,559 T23S probably damaging Het
Trib3 A T 2: 152,338,633 D213E probably damaging Het
Tubgcp4 T C 2: 121,183,500 V178A probably benign Het
Virma T A 4: 11,539,918 C1412* probably null Het
Vmn2r108 T C 17: 20,471,500 T254A probably benign Het
Vps13d A G 4: 145,155,567 V1152A Het
Wdr47 T C 3: 108,618,968 V269A probably damaging Het
Zc3h13 T A 14: 75,324,537 D676E unknown Het
Zc3h6 T A 2: 129,017,014 S988R probably benign Het
Other mutations in Eln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Eln APN 5 134719040 intron probably benign
IGL01941:Eln APN 5 134718170 intron probably benign
IGL02508:Eln APN 5 134704568 utr 3 prime probably benign
IGL02654:Eln APN 5 134717054 intron probably benign
PIT4696001:Eln UTSW 5 134737178 missense unknown
R0036:Eln UTSW 5 134711060 critical splice donor site probably null
R0594:Eln UTSW 5 134712398 splice site probably benign
R0849:Eln UTSW 5 134707981 nonsense probably null
R1434:Eln UTSW 5 134729437 splice site probably benign
R1481:Eln UTSW 5 134706572 missense probably damaging 0.99
R1682:Eln UTSW 5 134703782 makesense probably null
R1741:Eln UTSW 5 134729184 missense unknown
R1926:Eln UTSW 5 134706567 nonsense probably null
R1983:Eln UTSW 5 134736340 splice site probably null
R2033:Eln UTSW 5 134710106 critical splice donor site probably null
R2259:Eln UTSW 5 134729654 missense unknown
R2260:Eln UTSW 5 134729654 missense unknown
R4450:Eln UTSW 5 134725781 intron probably benign
R6502:Eln UTSW 5 134725774 intron probably benign
R7249:Eln UTSW 5 134711081 utr 3 prime probably benign
R7479:Eln UTSW 5 134707575 missense unknown
R7819:Eln UTSW 5 134737181 missense unknown
R7855:Eln UTSW 5 134711081 utr 3 prime probably benign
R7873:Eln UTSW 5 134711187 missense unknown
R7956:Eln UTSW 5 134711187 missense unknown
R7982:Eln UTSW 5 134711081 utr 3 prime probably benign
R8047:Eln UTSW 5 134729149 small deletion probably benign
R8073:Eln UTSW 5 134729149 small deletion probably benign
Z1177:Eln UTSW 5 134718026 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCCAATCACAGGTCTGTTG -3'
(R):5'- AGTACACACTTCTTGTCTGACC -3'

Sequencing Primer
(F):5'- CAATCACAGGTCTGTTGCTTTGGATC -3'
(R):5'- TGTTCCTGGCTACGCAGG -3'
Posted On2020-01-23