Incidental Mutation 'R8048:Sbf2'
ID618881
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene NameSET binding factor 2
SynonymsmMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2
MMRRC Submission
Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R8048 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location110308013-110614922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110315082 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1631 (E1631G)
Ref Sequence ENSEMBL: ENSMUSP00000033058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]
Predicted Effect probably benign
Transcript: ENSMUST00000033058
AA Change: E1631G

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: E1631G

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164759
AA Change: E1606G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: E1606G

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166020
AA Change: E1585G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: E1585G

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,410,844 L318F probably damaging Het
Alms1 T A 6: 85,641,334 S2318R probably benign Het
Arhgap12 G A 18: 6,052,883 T443I probably benign Het
Arhgap29 C T 3: 121,992,901 R372W probably damaging Het
Astn1 T C 1: 158,688,638 I1266T probably benign Het
Bsg T C 10: 79,709,746 V164A probably benign Het
C1qa G T 4: 136,896,610 S94R probably benign Het
Cadps2 A G 6: 23,838,863 V92A probably benign Het
Ccdc187 T A 2: 26,293,514 D158V possibly damaging Het
Cngb1 T A 8: 95,263,210 Y758F possibly damaging Het
Ddx4 G A 13: 112,622,172 A285V probably null Het
Dsg1c A T 18: 20,274,767 K390M probably damaging Het
Dst T C 1: 34,190,636 F2437L probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam227a CATTGTCTTGA CA 15: 79,649,758 probably null Het
Fez2 T C 17: 78,387,053 I303V probably benign Het
Ffar1 A T 7: 30,860,578 I298N probably benign Het
Hpx C T 7: 105,595,478 V228I probably benign Het
Igkv1-117 T G 6: 68,121,802 C112G probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Ivl T A 3: 92,571,924 K278M probably damaging Het
Lyst A G 13: 13,687,645 T2589A probably benign Het
Madd A T 2: 91,154,448 M1359K probably damaging Het
Nav3 T C 10: 109,764,918 T1283A probably benign Het
Ncapd2 G T 6: 125,179,698 C439* probably null Het
Nebl T C 2: 17,424,522 D266G probably benign Het
Oas1f G T 5: 120,847,537 G49V probably damaging Het
Oas1f A T 5: 120,848,416 Q144L possibly damaging Het
Olfr1032 T G 2: 86,008,180 S135A probably damaging Het
Olfr1052 C T 2: 86,298,328 P171S probably benign Het
Olfr1062 T A 2: 86,423,307 Y123F probably damaging Het
Olfr134 T C 17: 38,175,528 V148A probably benign Het
Olfr141 T A 2: 86,806,171 Y276F probably damaging Het
Olfr1440 A G 19: 12,394,355 I31V not run Het
Olfr324 A G 11: 58,597,407 I6V unknown Het
Olfr711 C T 7: 106,972,464 probably benign Het
Olfr740 T C 14: 50,453,916 L288P possibly damaging Het
Olfr917 C T 9: 38,665,812 E11K probably benign Het
Pard3b T A 1: 62,153,989 V217E probably damaging Het
Pcdha2 T A 18: 36,939,460 I48N probably damaging Het
Pi4ka A G 16: 17,303,127 F1248L Het
Plekha2 A T 8: 25,063,989 probably benign Het
Plpp4 C T 7: 129,379,477 R151C unknown Het
Pramef17 T A 4: 143,991,607 Y422F probably benign Het
Prdm16 A G 4: 154,320,882 L1245P probably damaging Het
Prob1 G A 18: 35,653,551 A550V probably benign Het
Prok1 T C 3: 107,237,092 H65R probably benign Het
Ptcd1 A G 5: 145,155,077 V404A probably benign Het
Sdad1 C A 5: 92,300,089 K262N probably benign Het
Sh3bp1 G T 15: 78,910,072 A547S probably benign Het
Sptb T C 12: 76,628,559 D227G probably benign Het
Tbx1 A G 16: 18,588,019 M1T probably null Het
Tespa1 T A 10: 130,347,339 V51D probably damaging Het
Tmc7 T C 7: 118,566,245 N82S probably benign Het
Tmem8b A G 4: 43,689,476 D290G possibly damaging Het
Trbv13-2 A T 6: 41,121,559 T23S probably damaging Het
Trib3 A T 2: 152,338,633 D213E probably damaging Het
Tubgcp4 T C 2: 121,183,500 V178A probably benign Het
Virma T A 4: 11,539,918 C1412* probably null Het
Vmn2r108 T C 17: 20,471,500 T254A probably benign Het
Vps13d A G 4: 145,155,567 V1152A Het
Wdr47 T C 3: 108,618,968 V269A probably damaging Het
Zc3h13 T A 14: 75,324,537 D676E unknown Het
Zc3h6 T A 2: 129,017,014 S988R probably benign Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 110375832 splice site probably benign
IGL01089:Sbf2 APN 7 110348962 missense probably damaging 1.00
IGL01144:Sbf2 APN 7 110329903 missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110447120 missense probably damaging 1.00
IGL01950:Sbf2 APN 7 110365825 missense probably benign 0.00
IGL02027:Sbf2 APN 7 110461141 missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110560295 missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110462956 missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110462932 missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 110312752 missense probably benign
R0084:Sbf2 UTSW 7 110442366 missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 110320806 splice site probably benign
R0121:Sbf2 UTSW 7 110489219 critical splice donor site probably null
R0464:Sbf2 UTSW 7 110464576 splice site probably benign
R0505:Sbf2 UTSW 7 110399343 missense probably damaging 1.00
R0531:Sbf2 UTSW 7 110367323 splice site probably benign
R0554:Sbf2 UTSW 7 110428287 missense probably damaging 1.00
R0617:Sbf2 UTSW 7 110330683 frame shift probably null
R0619:Sbf2 UTSW 7 110310262 missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 110341355 missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 110371652 missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 110367172 splice site probably benign
R1167:Sbf2 UTSW 7 110364549 missense probably damaging 1.00
R1169:Sbf2 UTSW 7 110310184 missense probably benign 0.04
R1424:Sbf2 UTSW 7 110315026 missense probably damaging 1.00
R1536:Sbf2 UTSW 7 110378043 missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110428346 missense probably damaging 1.00
R1601:Sbf2 UTSW 7 110340076 critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 110312758 missense probably benign
R1771:Sbf2 UTSW 7 110461146 nonsense probably null
R1989:Sbf2 UTSW 7 110348923 missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110461212 missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110560295 missense probably damaging 1.00
R2444:Sbf2 UTSW 7 110330698 missense probably benign 0.31
R3765:Sbf2 UTSW 7 110375581 missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110489280 makesense probably null
R3895:Sbf2 UTSW 7 110447091 missense probably damaging 0.99
R3978:Sbf2 UTSW 7 110329885 missense probably benign 0.00
R4056:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110428242 missense probably damaging 1.00
R4569:Sbf2 UTSW 7 110348853 critical splice donor site probably null
R4670:Sbf2 UTSW 7 110335399 missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110420917 missense probably damaging 1.00
R4792:Sbf2 UTSW 7 110351610 missense probably damaging 0.98
R4811:Sbf2 UTSW 7 110372535 missense probably damaging 1.00
R4822:Sbf2 UTSW 7 110377939 intron probably benign
R5110:Sbf2 UTSW 7 110364657 missense probably benign 0.10
R5143:Sbf2 UTSW 7 110422540 nonsense probably null
R5443:Sbf2 UTSW 7 110377928 intron probably benign
R5457:Sbf2 UTSW 7 110312830 missense probably benign
R5641:Sbf2 UTSW 7 110438901 missense probably damaging 1.00
R5915:Sbf2 UTSW 7 110378096 nonsense probably null
R5948:Sbf2 UTSW 7 110489285 missense probably damaging 1.00
R5977:Sbf2 UTSW 7 110377986 missense probably benign 0.00
R6052:Sbf2 UTSW 7 110441534 missense probably damaging 1.00
R6142:Sbf2 UTSW 7 110348975 missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110441552 missense probably damaging 1.00
R6356:Sbf2 UTSW 7 110372623 missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110462863 missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110440975 missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110560298 missense probably benign 0.04
R6986:Sbf2 UTSW 7 110330615 missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110447061 missense probably benign 0.01
R7358:Sbf2 UTSW 7 110399348 missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 110314064 missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 110365821 missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110438848 missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 110375777 nonsense probably null
R7431:Sbf2 UTSW 7 110351750 missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110614716 nonsense probably null
R7556:Sbf2 UTSW 7 110314053 missense probably benign 0.20
R7604:Sbf2 UTSW 7 110378067 missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 110330713 critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110441426 missense probably benign 0.01
R7812:Sbf2 UTSW 7 110449963 missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 110372510 missense probably damaging 1.00
R8026:Sbf2 UTSW 7 110335387 missense probably damaging 1.00
R8305:Sbf2 UTSW 7 110371618 missense possibly damaging 0.79
R8337:Sbf2 UTSW 7 110441462 missense probably benign
RF005:Sbf2 UTSW 7 110317008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCCATTACAGATGCAAGTAC -3'
(R):5'- GGGTTGCCTAGTAGTGAGTACC -3'

Sequencing Primer
(F):5'- CGCAAGTTAGTCCAAGCTGC -3'
(R):5'- GTTGCCTAGTAGTGAGTACCAAGTAC -3'
Posted On2020-01-23