Incidental Mutation 'R8048:Bsg'
ID618886
Institutional Source Beutler Lab
Gene Symbol Bsg
Ensembl Gene ENSMUSG00000023175
Gene Namebasigin
SynonymsEMMPRIN, 5A11/Basigin, CD147, neurothelin, gp 42, HT-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R8048 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79704491-79711969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79709746 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000070751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067036] [ENSMUST00000105381] [ENSMUST00000179781]
Predicted Effect probably benign
Transcript: ENSMUST00000067036
AA Change: V164A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000070751
Gene: ENSMUSG00000023175
AA Change: V164A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
IGc2 35 115 5.75e-4 SMART
IG 227 323 1.27e-5 SMART
transmembrane domain 327 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105381
SMART Domains Protein: ENSMUSP00000101020
Gene: ENSMUSG00000023175

DomainStartEndE-ValueType
Blast:IG_like 1 46 7e-12 BLAST
IG 56 152 1.27e-5 SMART
transmembrane domain 156 178 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000179781
AA Change: V48A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136487
Gene: ENSMUSG00000023175
AA Change: V48A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Blast:IG_like 26 97 1e-24 BLAST
IG 111 207 1.27e-5 SMART
transmembrane domain 211 233 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane protein that is important in spermatogenesis, embryo implantation, neural network formation, and tumor progression. The encoded protein is also a member of the immunoglobulin superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous null mutants die near the time of implantation. Half of the survivors die prior to 1 month of age from interstitial pneumonia. The remaining mice are small, sterile, have retinal abnormalities, and perform poorly in behavioral tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,410,844 L318F probably damaging Het
Alms1 T A 6: 85,641,334 S2318R probably benign Het
Arhgap12 G A 18: 6,052,883 T443I probably benign Het
Arhgap29 C T 3: 121,992,901 R372W probably damaging Het
Astn1 T C 1: 158,688,638 I1266T probably benign Het
C1qa G T 4: 136,896,610 S94R probably benign Het
Cadps2 A G 6: 23,838,863 V92A probably benign Het
Ccdc187 T A 2: 26,293,514 D158V possibly damaging Het
Cngb1 T A 8: 95,263,210 Y758F possibly damaging Het
Ddx4 G A 13: 112,622,172 A285V probably null Het
Dsg1c A T 18: 20,274,767 K390M probably damaging Het
Dst T C 1: 34,190,636 F2437L probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam227a CATTGTCTTGA CA 15: 79,649,758 probably null Het
Fez2 T C 17: 78,387,053 I303V probably benign Het
Ffar1 A T 7: 30,860,578 I298N probably benign Het
Hpx C T 7: 105,595,478 V228I probably benign Het
Igkv1-117 T G 6: 68,121,802 C112G probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Ivl T A 3: 92,571,924 K278M probably damaging Het
Lyst A G 13: 13,687,645 T2589A probably benign Het
Madd A T 2: 91,154,448 M1359K probably damaging Het
Nav3 T C 10: 109,764,918 T1283A probably benign Het
Ncapd2 G T 6: 125,179,698 C439* probably null Het
Nebl T C 2: 17,424,522 D266G probably benign Het
Oas1f G T 5: 120,847,537 G49V probably damaging Het
Oas1f A T 5: 120,848,416 Q144L possibly damaging Het
Olfr1032 T G 2: 86,008,180 S135A probably damaging Het
Olfr1052 C T 2: 86,298,328 P171S probably benign Het
Olfr1062 T A 2: 86,423,307 Y123F probably damaging Het
Olfr134 T C 17: 38,175,528 V148A probably benign Het
Olfr141 T A 2: 86,806,171 Y276F probably damaging Het
Olfr1440 A G 19: 12,394,355 I31V not run Het
Olfr324 A G 11: 58,597,407 I6V unknown Het
Olfr711 C T 7: 106,972,464 probably benign Het
Olfr740 T C 14: 50,453,916 L288P possibly damaging Het
Olfr917 C T 9: 38,665,812 E11K probably benign Het
Pard3b T A 1: 62,153,989 V217E probably damaging Het
Pcdha2 T A 18: 36,939,460 I48N probably damaging Het
Pi4ka A G 16: 17,303,127 F1248L Het
Plekha2 A T 8: 25,063,989 probably benign Het
Plpp4 C T 7: 129,379,477 R151C unknown Het
Pramef17 T A 4: 143,991,607 Y422F probably benign Het
Prdm16 A G 4: 154,320,882 L1245P probably damaging Het
Prob1 G A 18: 35,653,551 A550V probably benign Het
Prok1 T C 3: 107,237,092 H65R probably benign Het
Ptcd1 A G 5: 145,155,077 V404A probably benign Het
Sbf2 T C 7: 110,315,082 E1631G probably benign Het
Sdad1 C A 5: 92,300,089 K262N probably benign Het
Sh3bp1 G T 15: 78,910,072 A547S probably benign Het
Sptb T C 12: 76,628,559 D227G probably benign Het
Tbx1 A G 16: 18,588,019 M1T probably null Het
Tespa1 T A 10: 130,347,339 V51D probably damaging Het
Tmc7 T C 7: 118,566,245 N82S probably benign Het
Tmem8b A G 4: 43,689,476 D290G possibly damaging Het
Trbv13-2 A T 6: 41,121,559 T23S probably damaging Het
Trib3 A T 2: 152,338,633 D213E probably damaging Het
Tubgcp4 T C 2: 121,183,500 V178A probably benign Het
Virma T A 4: 11,539,918 C1412* probably null Het
Vmn2r108 T C 17: 20,471,500 T254A probably benign Het
Vps13d A G 4: 145,155,567 V1152A Het
Wdr47 T C 3: 108,618,968 V269A probably damaging Het
Zc3h13 T A 14: 75,324,537 D676E unknown Het
Zc3h6 T A 2: 129,017,014 S988R probably benign Het
Other mutations in Bsg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Bsg APN 10 79711514 missense probably benign 0.01
IGL01912:Bsg APN 10 79710140 missense probably null 1.00
R0840:Bsg UTSW 10 79709685 missense probably damaging 0.98
R1665:Bsg UTSW 10 79711518 missense probably damaging 1.00
R5119:Bsg UTSW 10 79710223 intron probably benign
R5397:Bsg UTSW 10 79708795 missense probably damaging 1.00
R6208:Bsg UTSW 10 79708838 missense probably damaging 1.00
R7384:Bsg UTSW 10 79709797 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTTGCTTTAGCCGTCTGG -3'
(R):5'- CTATACAGGTAAGGCCACCCAG -3'

Sequencing Primer
(F):5'- CTGGGGCTGTAGACTGTCAG -3'
(R):5'- AGCCAATCCAGAGCTGTGTG -3'
Posted On2020-01-23