Incidental Mutation 'R8048:Lyst'
ID 618891
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Name lysosomal trafficking regulator
Synonyms D13Sfk13
MMRRC Submission 067485-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.395) question?
Stock # R8048 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 13764982-13953388 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13862230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2589 (T2589A)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110559
AA Change: T2589A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: T2589A

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231064
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,228,708 (GRCm39) L318F probably damaging Het
Alms1 T A 6: 85,618,316 (GRCm39) S2318R probably benign Het
Arhgap12 G A 18: 6,052,883 (GRCm39) T443I probably benign Het
Arhgap29 C T 3: 121,786,550 (GRCm39) R372W probably damaging Het
Astn1 T C 1: 158,516,208 (GRCm39) I1266T probably benign Het
Bsg T C 10: 79,545,580 (GRCm39) V164A probably benign Het
C1qa G T 4: 136,623,921 (GRCm39) S94R probably benign Het
Cadps2 A G 6: 23,838,862 (GRCm39) V92A probably benign Het
Ccdc187 T A 2: 26,183,526 (GRCm39) D158V possibly damaging Het
Cngb1 T A 8: 95,989,838 (GRCm39) Y758F possibly damaging Het
Ddx4 G A 13: 112,758,706 (GRCm39) A285V probably null Het
Dsg1c A T 18: 20,407,824 (GRCm39) K390M probably damaging Het
Dst T C 1: 34,229,717 (GRCm39) F2437L probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,758,003 (GRCm39) probably benign Het
Fam227a CATTGTCTTGA CA 15: 79,533,959 (GRCm39) probably null Het
Fez2 T C 17: 78,694,482 (GRCm39) I303V probably benign Het
Ffar1 A T 7: 30,560,003 (GRCm39) I298N probably benign Het
Hpx C T 7: 105,244,685 (GRCm39) V228I probably benign Het
Igkv1-117 T G 6: 68,098,786 (GRCm39) C112G probably damaging Het
Il3ra A G 14: 14,348,903 (GRCm38) D99G probably benign Het
Ivl T A 3: 92,479,231 (GRCm39) K278M probably damaging Het
Madd A T 2: 90,984,793 (GRCm39) M1359K probably damaging Het
Nav3 T C 10: 109,600,779 (GRCm39) T1283A probably benign Het
Ncapd2 G T 6: 125,156,661 (GRCm39) C439* probably null Het
Nebl T C 2: 17,429,333 (GRCm39) D266G probably benign Het
Oas1f G T 5: 120,985,602 (GRCm39) G49V probably damaging Het
Oas1f A T 5: 120,986,479 (GRCm39) Q144L possibly damaging Het
Or11g7 T C 14: 50,691,373 (GRCm39) L288P possibly damaging Het
Or2ab1 A G 11: 58,488,233 (GRCm39) I6V unknown Het
Or2n1 T C 17: 38,486,419 (GRCm39) V148A probably benign Het
Or5an6 A G 19: 12,371,719 (GRCm39) I31V not run Het
Or5j3 C T 2: 86,128,672 (GRCm39) P171S probably benign Het
Or5m3 T G 2: 85,838,524 (GRCm39) S135A probably damaging Het
Or5t18 T A 2: 86,636,515 (GRCm39) Y276F probably damaging Het
Or6b6 C T 7: 106,571,671 (GRCm39) probably benign Het
Or8b52 C T 9: 38,577,108 (GRCm39) E11K probably benign Het
Or8j3c T A 2: 86,253,651 (GRCm39) Y123F probably damaging Het
Pard3b T A 1: 62,193,148 (GRCm39) V217E probably damaging Het
Pcdha2 T A 18: 37,072,513 (GRCm39) I48N probably damaging Het
Pi4ka A G 16: 17,120,991 (GRCm39) F1248L Het
Plekha2 A T 8: 25,554,005 (GRCm39) probably benign Het
Plpp4 C T 7: 128,981,201 (GRCm39) R151C unknown Het
Pramel14 T A 4: 143,718,177 (GRCm39) Y422F probably benign Het
Prdm16 A G 4: 154,405,339 (GRCm39) L1245P probably damaging Het
Prob1 G A 18: 35,786,604 (GRCm39) A550V probably benign Het
Prok1 T C 3: 107,144,408 (GRCm39) H65R probably benign Het
Ptcd1 A G 5: 145,091,887 (GRCm39) V404A probably benign Het
Sbf2 T C 7: 109,914,289 (GRCm39) E1631G probably benign Het
Sdad1 C A 5: 92,447,948 (GRCm39) K262N probably benign Het
Sh3bp1 G T 15: 78,794,272 (GRCm39) A547S probably benign Het
Sptb T C 12: 76,675,333 (GRCm39) D227G probably benign Het
Tbx1 A G 16: 18,406,769 (GRCm39) M1T probably null Het
Tespa1 T A 10: 130,183,208 (GRCm39) V51D probably damaging Het
Tmc7 T C 7: 118,165,468 (GRCm39) N82S probably benign Het
Tmem8b A G 4: 43,689,476 (GRCm39) D290G possibly damaging Het
Trbv13-2 A T 6: 41,098,493 (GRCm39) T23S probably damaging Het
Trib3 A T 2: 152,180,553 (GRCm39) D213E probably damaging Het
Tubgcp4 T C 2: 121,013,981 (GRCm39) V178A probably benign Het
Virma T A 4: 11,539,918 (GRCm39) C1412* probably null Het
Vmn2r108 T C 17: 20,691,762 (GRCm39) T254A probably benign Het
Vps13d A G 4: 144,882,137 (GRCm39) V1152A Het
Wdr47 T C 3: 108,526,284 (GRCm39) V269A probably damaging Het
Zc3h13 T A 14: 75,561,977 (GRCm39) D676E unknown Het
Zc3h6 T A 2: 128,858,934 (GRCm39) S988R probably benign Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13,823,463 (GRCm39) missense probably benign
IGL00474:Lyst APN 13 13,818,121 (GRCm39) missense possibly damaging 0.48
IGL00484:Lyst APN 13 13,884,188 (GRCm39) missense probably benign 0.02
IGL00492:Lyst APN 13 13,852,760 (GRCm39) missense possibly damaging 0.54
IGL00807:Lyst APN 13 13,825,008 (GRCm39) missense possibly damaging 0.91
IGL00949:Lyst APN 13 13,810,070 (GRCm39) missense possibly damaging 0.87
IGL00952:Lyst APN 13 13,852,692 (GRCm39) missense probably benign 0.05
IGL01305:Lyst APN 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL01317:Lyst APN 13 13,845,455 (GRCm39) missense probably benign
IGL01419:Lyst APN 13 13,810,423 (GRCm39) missense probably benign 0.00
IGL01445:Lyst APN 13 13,826,299 (GRCm39) missense probably benign 0.00
IGL01690:Lyst APN 13 13,917,831 (GRCm39) missense probably damaging 1.00
IGL01791:Lyst APN 13 13,809,887 (GRCm39) missense probably damaging 1.00
IGL01809:Lyst APN 13 13,812,388 (GRCm39) missense probably damaging 1.00
IGL01896:Lyst APN 13 13,810,162 (GRCm39) missense probably benign 0.04
IGL01938:Lyst APN 13 13,812,009 (GRCm39) missense possibly damaging 0.93
IGL01986:Lyst APN 13 13,950,212 (GRCm39) critical splice donor site probably null
IGL02022:Lyst APN 13 13,838,629 (GRCm39) nonsense probably null
IGL02044:Lyst APN 13 13,887,431 (GRCm39) missense probably damaging 1.00
IGL02157:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02185:Lyst APN 13 13,835,678 (GRCm39) nonsense probably null
IGL02215:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02245:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02246:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02247:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02297:Lyst APN 13 13,812,677 (GRCm39) nonsense probably null
IGL02411:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02415:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02419:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02420:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02429:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02501:Lyst APN 13 13,886,230 (GRCm39) missense probably benign 0.02
IGL02522:Lyst APN 13 13,809,290 (GRCm39) missense possibly damaging 0.81
IGL02535:Lyst APN 13 13,824,927 (GRCm39) missense probably benign 0.00
IGL02596:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02601:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02603:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02608:Lyst APN 13 13,887,339 (GRCm39) missense probably damaging 0.98
IGL02622:Lyst APN 13 13,855,975 (GRCm39) missense probably damaging 1.00
IGL02690:Lyst APN 13 13,815,710 (GRCm39) missense possibly damaging 0.58
IGL02715:Lyst APN 13 13,848,905 (GRCm39) splice site probably null
IGL02725:Lyst APN 13 13,935,412 (GRCm39) missense probably damaging 1.00
IGL02729:Lyst APN 13 13,921,194 (GRCm39) missense possibly damaging 0.95
IGL02729:Lyst APN 13 13,848,924 (GRCm39) missense possibly damaging 0.81
IGL02820:Lyst APN 13 13,812,643 (GRCm39) missense probably benign 0.03
IGL02945:Lyst APN 13 13,935,783 (GRCm39) missense possibly damaging 0.48
IGL02981:Lyst APN 13 13,809,496 (GRCm39) missense probably damaging 0.99
IGL03087:Lyst APN 13 13,809,641 (GRCm39) missense probably damaging 1.00
IGL03149:Lyst APN 13 13,856,029 (GRCm39) missense probably benign 0.14
IGL03158:Lyst APN 13 13,826,337 (GRCm39) critical splice donor site probably null
IGL03226:Lyst APN 13 13,884,144 (GRCm39) missense probably benign 0.01
IGL03242:Lyst APN 13 13,831,466 (GRCm39) nonsense probably null
IGL03385:Lyst APN 13 13,831,565 (GRCm39) nonsense probably null
50-cal UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
charcoal UTSW 13 13,871,346 (GRCm39) nonsense probably null
charlotte_gray UTSW 13 13,602,026 (GRCm38) intron probably benign
charzard UTSW 13 13,821,668 (GRCm39) nonsense probably null
grey_wolf UTSW 13 0 () unclassified
lightspeed UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
pardon UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
robin UTSW 13 13,823,387 (GRCm39) nonsense probably null
sooty UTSW 13 0 () unclassified
souris UTSW 13 13,857,808 (GRCm39) unclassified probably benign
Swallow UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
vulpix UTSW 13 13,871,379 (GRCm39) splice site probably null
ANU22:Lyst UTSW 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL02835:Lyst UTSW 13 13,835,685 (GRCm39) missense possibly damaging 0.82
P0031:Lyst UTSW 13 13,838,616 (GRCm39) missense probably damaging 1.00
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0031:Lyst UTSW 13 13,882,741 (GRCm39) missense probably benign 0.14
R0115:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0212:Lyst UTSW 13 13,810,570 (GRCm39) missense possibly damaging 0.93
R0386:Lyst UTSW 13 13,882,799 (GRCm39) splice site probably benign
R0393:Lyst UTSW 13 13,821,664 (GRCm39) missense probably benign 0.01
R0415:Lyst UTSW 13 13,886,195 (GRCm39) splice site probably benign
R0446:Lyst UTSW 13 13,812,633 (GRCm39) missense probably benign 0.00
R0481:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0499:Lyst UTSW 13 13,791,298 (GRCm39) missense probably damaging 1.00
R0506:Lyst UTSW 13 13,812,600 (GRCm39) missense probably benign
R0530:Lyst UTSW 13 13,931,891 (GRCm39) splice site probably benign
R0541:Lyst UTSW 13 13,855,878 (GRCm39) missense probably benign 0.00
R0570:Lyst UTSW 13 13,883,971 (GRCm39) missense probably benign 0.26
R0680:Lyst UTSW 13 13,824,926 (GRCm39) missense probably benign 0.01
R0842:Lyst UTSW 13 13,852,826 (GRCm39) nonsense probably null
R0848:Lyst UTSW 13 13,809,515 (GRCm39) missense probably benign 0.00
R1014:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.49
R1205:Lyst UTSW 13 13,854,787 (GRCm39) missense probably benign
R1251:Lyst UTSW 13 13,809,068 (GRCm39) missense probably benign 0.00
R1304:Lyst UTSW 13 13,926,569 (GRCm39) nonsense probably null
R1398:Lyst UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
R1445:Lyst UTSW 13 13,814,639 (GRCm39) missense possibly damaging 0.94
R1475:Lyst UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
R1479:Lyst UTSW 13 13,809,067 (GRCm39) missense probably benign 0.00
R1484:Lyst UTSW 13 13,852,775 (GRCm39) missense probably benign 0.01
R1498:Lyst UTSW 13 13,824,960 (GRCm39) missense possibly damaging 0.49
R1540:Lyst UTSW 13 13,809,686 (GRCm39) missense possibly damaging 0.81
R1611:Lyst UTSW 13 13,809,482 (GRCm39) missense probably damaging 0.97
R1653:Lyst UTSW 13 13,809,811 (GRCm39) missense probably damaging 1.00
R1669:Lyst UTSW 13 13,818,672 (GRCm39) missense possibly damaging 0.90
R1686:Lyst UTSW 13 13,809,290 (GRCm39) missense possibly damaging 0.81
R1694:Lyst UTSW 13 13,835,746 (GRCm39) missense probably damaging 0.98
R1747:Lyst UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
R1793:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R1871:Lyst UTSW 13 13,826,297 (GRCm39) missense probably benign 0.00
R1905:Lyst UTSW 13 13,808,719 (GRCm39) missense probably benign
R1958:Lyst UTSW 13 13,791,203 (GRCm39) missense probably damaging 1.00
R1969:Lyst UTSW 13 13,904,929 (GRCm39) missense probably damaging 0.99
R2040:Lyst UTSW 13 13,815,807 (GRCm39) missense probably benign 0.00
R2109:Lyst UTSW 13 13,887,405 (GRCm39) missense possibly damaging 0.46
R2116:Lyst UTSW 13 13,810,286 (GRCm39) missense probably damaging 0.99
R2121:Lyst UTSW 13 13,835,556 (GRCm39) missense probably damaging 1.00
R2127:Lyst UTSW 13 13,809,847 (GRCm39) missense probably damaging 1.00
R2187:Lyst UTSW 13 13,883,926 (GRCm39) missense possibly damaging 0.61
R2238:Lyst UTSW 13 13,917,848 (GRCm39) missense probably benign 0.41
R2258:Lyst UTSW 13 13,812,243 (GRCm39) missense probably benign 0.00
R2292:Lyst UTSW 13 13,915,080 (GRCm39) missense probably damaging 1.00
R2368:Lyst UTSW 13 13,871,248 (GRCm39) missense probably damaging 0.96
R2908:Lyst UTSW 13 13,844,458 (GRCm39) missense probably benign 0.03
R3001:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3002:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3024:Lyst UTSW 13 13,833,272 (GRCm39) missense probably benign
R3113:Lyst UTSW 13 13,844,512 (GRCm39) missense probably benign 0.12
R3406:Lyst UTSW 13 13,809,815 (GRCm39) missense possibly damaging 0.56
R3972:Lyst UTSW 13 13,881,210 (GRCm39) missense possibly damaging 0.67
R3978:Lyst UTSW 13 13,808,753 (GRCm39) missense possibly damaging 0.82
R4032:Lyst UTSW 13 13,791,250 (GRCm39) missense probably damaging 1.00
R4192:Lyst UTSW 13 13,915,098 (GRCm39) missense probably damaging 1.00
R4206:Lyst UTSW 13 13,810,574 (GRCm39) missense probably benign 0.03
R4298:Lyst UTSW 13 13,809,472 (GRCm39) missense probably damaging 1.00
R4344:Lyst UTSW 13 13,873,051 (GRCm39) missense probably benign 0.06
R4441:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4445:Lyst UTSW 13 13,884,149 (GRCm39) missense probably benign 0.42
R4477:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4493:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4494:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4495:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4622:Lyst UTSW 13 13,848,983 (GRCm39) missense probably benign 0.01
R4638:Lyst UTSW 13 13,871,379 (GRCm39) splice site probably null
R4658:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4675:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4719:Lyst UTSW 13 13,824,935 (GRCm39) missense probably benign
R4729:Lyst UTSW 13 13,812,486 (GRCm39) missense probably damaging 1.00
R4774:Lyst UTSW 13 13,915,182 (GRCm39) missense probably damaging 1.00
R4811:Lyst UTSW 13 13,951,685 (GRCm39) missense probably benign 0.33
R4877:Lyst UTSW 13 13,857,734 (GRCm39) missense probably damaging 1.00
R4920:Lyst UTSW 13 13,821,645 (GRCm39) missense possibly damaging 0.79
R4933:Lyst UTSW 13 13,933,963 (GRCm39) missense probably benign 0.12
R4933:Lyst UTSW 13 13,812,349 (GRCm39) missense probably damaging 0.98
R4958:Lyst UTSW 13 13,810,048 (GRCm39) missense probably benign 0.00
R4982:Lyst UTSW 13 13,900,539 (GRCm39) missense probably damaging 1.00
R4992:Lyst UTSW 13 13,835,748 (GRCm39) missense probably damaging 1.00
R5024:Lyst UTSW 13 13,808,989 (GRCm39) missense probably benign
R5049:Lyst UTSW 13 13,810,649 (GRCm39) missense probably damaging 1.00
R5079:Lyst UTSW 13 13,931,938 (GRCm39) missense probably benign 0.08
R5254:Lyst UTSW 13 13,857,655 (GRCm39) missense probably benign 0.00
R5266:Lyst UTSW 13 13,835,555 (GRCm39) missense probably damaging 1.00
R5279:Lyst UTSW 13 13,823,387 (GRCm39) nonsense probably null
R5285:Lyst UTSW 13 13,809,011 (GRCm39) missense probably benign 0.01
R5364:Lyst UTSW 13 13,831,439 (GRCm39) missense probably benign 0.35
R5435:Lyst UTSW 13 13,951,649 (GRCm39) missense possibly damaging 0.64
R5516:Lyst UTSW 13 13,818,707 (GRCm39) missense probably benign 0.10
R5524:Lyst UTSW 13 13,921,364 (GRCm39) missense probably benign 0.03
R5591:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5592:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5593:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,933,982 (GRCm39) missense probably benign 0.00
R5644:Lyst UTSW 13 13,812,081 (GRCm39) missense possibly damaging 0.58
R5659:Lyst UTSW 13 13,809,212 (GRCm39) missense possibly damaging 0.58
R5741:Lyst UTSW 13 13,808,615 (GRCm39) missense probably benign 0.44
R5908:Lyst UTSW 13 13,871,346 (GRCm39) nonsense probably null
R5969:Lyst UTSW 13 13,862,398 (GRCm39) splice site probably null
R6128:Lyst UTSW 13 13,933,964 (GRCm39) missense possibly damaging 0.67
R6271:Lyst UTSW 13 13,833,339 (GRCm39) missense probably benign 0.30
R6315:Lyst UTSW 13 13,818,089 (GRCm39) missense probably benign
R6318:Lyst UTSW 13 13,917,896 (GRCm39) missense possibly damaging 0.88
R6555:Lyst UTSW 13 13,823,510 (GRCm39) missense probably benign 0.01
R6663:Lyst UTSW 13 13,838,701 (GRCm39) splice site probably null
R6701:Lyst UTSW 13 13,856,070 (GRCm39) missense probably benign 0.06
R6711:Lyst UTSW 13 13,809,820 (GRCm39) missense possibly damaging 0.80
R6909:Lyst UTSW 13 13,917,960 (GRCm39) missense probably damaging 1.00
R6915:Lyst UTSW 13 13,900,629 (GRCm39) missense probably benign 0.01
R6929:Lyst UTSW 13 13,917,909 (GRCm39) missense probably damaging 1.00
R6960:Lyst UTSW 13 13,808,663 (GRCm39) missense probably benign 0.12
R7018:Lyst UTSW 13 13,918,044 (GRCm39) critical splice donor site probably null
R7037:Lyst UTSW 13 13,791,251 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,812,293 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,809,485 (GRCm39) missense probably benign 0.34
R7070:Lyst UTSW 13 13,932,029 (GRCm39) missense probably benign 0.23
R7188:Lyst UTSW 13 13,926,675 (GRCm39) missense possibly damaging 0.66
R7201:Lyst UTSW 13 13,883,885 (GRCm39) nonsense probably null
R7210:Lyst UTSW 13 13,831,568 (GRCm39) missense probably damaging 1.00
R7229:Lyst UTSW 13 13,818,094 (GRCm39) missense probably benign 0.00
R7293:Lyst UTSW 13 13,854,822 (GRCm39) missense probably benign 0.01
R7318:Lyst UTSW 13 13,932,028 (GRCm39) missense probably benign 0.13
R7344:Lyst UTSW 13 13,881,140 (GRCm39) missense probably benign
R7426:Lyst UTSW 13 13,812,109 (GRCm39) missense probably benign
R7522:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R7583:Lyst UTSW 13 13,810,472 (GRCm39) missense probably damaging 1.00
R7606:Lyst UTSW 13 13,812,060 (GRCm39) missense probably damaging 1.00
R7636:Lyst UTSW 13 13,791,332 (GRCm39) critical splice donor site probably null
R7658:Lyst UTSW 13 13,905,061 (GRCm39) missense possibly damaging 0.63
R7685:Lyst UTSW 13 13,844,450 (GRCm39) missense probably benign 0.00
R7689:Lyst UTSW 13 13,857,808 (GRCm39) critical splice donor site probably null
R7765:Lyst UTSW 13 13,884,117 (GRCm39) missense possibly damaging 0.75
R7779:Lyst UTSW 13 13,809,128 (GRCm39) missense probably damaging 1.00
R7871:Lyst UTSW 13 13,810,637 (GRCm39) nonsense probably null
R7872:Lyst UTSW 13 13,810,450 (GRCm39) missense probably benign 0.14
R7884:Lyst UTSW 13 13,882,268 (GRCm39) missense probably benign 0.09
R7890:Lyst UTSW 13 13,915,154 (GRCm39) missense probably damaging 0.99
R7916:Lyst UTSW 13 13,821,657 (GRCm39) missense possibly damaging 0.64
R7948:Lyst UTSW 13 13,921,174 (GRCm39) missense possibly damaging 0.59
R7956:Lyst UTSW 13 13,815,788 (GRCm39) missense possibly damaging 0.80
R8085:Lyst UTSW 13 13,808,894 (GRCm39) missense probably damaging 0.98
R8165:Lyst UTSW 13 13,872,945 (GRCm39) missense probably damaging 0.99
R8235:Lyst UTSW 13 13,935,323 (GRCm39) missense possibly damaging 0.69
R8237:Lyst UTSW 13 13,826,317 (GRCm39) missense probably benign 0.00
R8275:Lyst UTSW 13 13,950,667 (GRCm39) missense probably benign 0.02
R8300:Lyst UTSW 13 13,838,643 (GRCm39) missense possibly damaging 0.79
R8350:Lyst UTSW 13 13,824,973 (GRCm39) nonsense probably null
R8526:Lyst UTSW 13 13,935,391 (GRCm39) missense probably damaging 0.99
R8551:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.77
R8723:Lyst UTSW 13 13,887,342 (GRCm39) missense possibly damaging 0.89
R8772:Lyst UTSW 13 13,812,077 (GRCm39) nonsense probably null
R8778:Lyst UTSW 13 13,903,152 (GRCm39) missense possibly damaging 0.89
R8778:Lyst UTSW 13 13,810,361 (GRCm39) missense possibly damaging 0.89
R8801:Lyst UTSW 13 13,835,595 (GRCm39) missense probably benign 0.10
R8837:Lyst UTSW 13 13,852,548 (GRCm39) missense probably benign
R8874:Lyst UTSW 13 13,812,147 (GRCm39) missense probably benign
R8878:Lyst UTSW 13 13,815,661 (GRCm39) missense probably benign 0.00
R8891:Lyst UTSW 13 13,887,435 (GRCm39) missense possibly damaging 0.67
R9077:Lyst UTSW 13 13,857,693 (GRCm39) missense probably benign 0.02
R9127:Lyst UTSW 13 13,808,827 (GRCm39) missense probably damaging 1.00
R9143:Lyst UTSW 13 13,835,750 (GRCm39) missense probably damaging 0.98
R9216:Lyst UTSW 13 13,823,188 (GRCm39) missense probably benign
R9217:Lyst UTSW 13 13,871,245 (GRCm39) missense probably benign 0.01
R9291:Lyst UTSW 13 13,883,938 (GRCm39) missense probably benign 0.01
R9302:Lyst UTSW 13 13,904,947 (GRCm39) missense possibly damaging 0.46
R9370:Lyst UTSW 13 13,935,333 (GRCm39) missense probably damaging 1.00
R9402:Lyst UTSW 13 13,812,463 (GRCm39) missense probably benign
R9457:Lyst UTSW 13 13,862,330 (GRCm39) missense possibly damaging 0.83
R9481:Lyst UTSW 13 13,857,653 (GRCm39) missense possibly damaging 0.68
R9563:Lyst UTSW 13 13,812,408 (GRCm39) missense probably benign 0.36
R9623:Lyst UTSW 13 13,852,587 (GRCm39) missense probably benign
R9661:Lyst UTSW 13 13,808,779 (GRCm39) missense probably benign 0.01
R9682:Lyst UTSW 13 13,831,526 (GRCm39) missense probably benign 0.21
R9743:Lyst UTSW 13 13,809,323 (GRCm39) missense possibly damaging 0.67
R9801:Lyst UTSW 13 13,809,290 (GRCm39) missense probably damaging 0.97
RF001:Lyst UTSW 13 13,810,426 (GRCm39) missense probably benign
RF002:Lyst UTSW 13 13,808,948 (GRCm39) missense probably benign 0.05
X0024:Lyst UTSW 13 13,809,033 (GRCm39) missense probably benign 0.00
X0026:Lyst UTSW 13 13,926,555 (GRCm39) missense probably damaging 0.99
Z1088:Lyst UTSW 13 13,918,018 (GRCm39) missense probably benign 0.09
Z1176:Lyst UTSW 13 13,951,664 (GRCm39) missense probably benign 0.27
Z1176:Lyst UTSW 13 13,814,692 (GRCm39) missense probably damaging 1.00
Z1177:Lyst UTSW 13 13,854,719 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGAATCCAGAAGTACTGTTCCAC -3'
(R):5'- AGGAGTGGGGTCTAAGATACCTTG -3'

Sequencing Primer
(F):5'- CTGTTCCACTTCTTTGGAGAAAG -3'
(R):5'- CCTTGGTAAATAATCCTGTTCACAGC -3'
Posted On 2020-01-23