Incidental Mutation 'R8048:Il3ra'
ID618893
Institutional Source Beutler Lab
Gene Symbol Il3ra
Ensembl Gene ENSMUSG00000068758
Gene Nameinterleukin 3 receptor, alpha chain
SynonymsIL-3 receptor alpha chain, CD123, SUT-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8048 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location14346275-14356011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14348903 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 99 (D99G)
Ref Sequence ENSEMBL: ENSMUSP00000153460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090591] [ENSMUST00000223589] [ENSMUST00000224163] [ENSMUST00000224877] [ENSMUST00000225775]
Predicted Effect probably benign
Transcript: ENSMUST00000090591
AA Change: D99G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000088079
Gene: ENSMUSG00000068758
AA Change: D99G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL6Ra-bind 119 233 6.1e-33 PFAM
transmembrane domain 333 355 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223589
AA Change: D99G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000224163
AA Change: D99G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224415
Predicted Effect probably benign
Transcript: ENSMUST00000224877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225560
Predicted Effect probably benign
Transcript: ENSMUST00000225775
AA Change: D99G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012]
PHENOTYPE: A number of distantly related inbred mouse strains carrying an identical spontaneous deletion at the branch point in intron 7 exhibit a reduced capacity of bone marrow cells to form colonies in response to interleukin-3 in CFU-GM assays. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,410,844 L318F probably damaging Het
Alms1 T A 6: 85,641,334 S2318R probably benign Het
Arhgap12 G A 18: 6,052,883 T443I probably benign Het
Arhgap29 C T 3: 121,992,901 R372W probably damaging Het
Astn1 T C 1: 158,688,638 I1266T probably benign Het
Bsg T C 10: 79,709,746 V164A probably benign Het
C1qa G T 4: 136,896,610 S94R probably benign Het
Cadps2 A G 6: 23,838,863 V92A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc187 T A 2: 26,293,514 D158V possibly damaging Het
Cngb1 T A 8: 95,263,210 Y758F possibly damaging Het
Ddx4 G A 13: 112,622,172 A285V probably null Het
Dsg1c A T 18: 20,274,767 K390M probably damaging Het
Dst T C 1: 34,190,636 F2437L probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam227a CATTGTCTTGA CA 15: 79,649,758 probably null Het
Fez2 T C 17: 78,387,053 I303V probably benign Het
Ffar1 A T 7: 30,860,578 I298N probably benign Het
Hpx C T 7: 105,595,478 V228I probably benign Het
Igkv1-117 T G 6: 68,121,802 C112G probably damaging Het
Ivl T A 3: 92,571,924 K278M probably damaging Het
Lyst A G 13: 13,687,645 T2589A probably benign Het
Madd A T 2: 91,154,448 M1359K probably damaging Het
Nav3 T C 10: 109,764,918 T1283A probably benign Het
Ncapd2 G T 6: 125,179,698 C439* probably null Het
Nebl T C 2: 17,424,522 D266G probably benign Het
Oas1f G T 5: 120,847,537 G49V probably damaging Het
Oas1f A T 5: 120,848,416 Q144L possibly damaging Het
Olfr1032 T G 2: 86,008,180 S135A probably damaging Het
Olfr1052 C T 2: 86,298,328 P171S probably benign Het
Olfr1062 T A 2: 86,423,307 Y123F probably damaging Het
Olfr134 T C 17: 38,175,528 V148A probably benign Het
Olfr141 T A 2: 86,806,171 Y276F probably damaging Het
Olfr1440 A G 19: 12,394,355 I31V not run Het
Olfr324 A G 11: 58,597,407 I6V unknown Het
Olfr711 C T 7: 106,972,464 probably benign Het
Olfr740 T C 14: 50,453,916 L288P possibly damaging Het
Olfr917 C T 9: 38,665,812 E11K probably benign Het
Pard3b T A 1: 62,153,989 V217E probably damaging Het
Pcdha2 T A 18: 36,939,460 I48N probably damaging Het
Pi4ka A G 16: 17,303,127 F1248L Het
Plpp4 C T 7: 129,379,477 R151C unknown Het
Pramef17 T A 4: 143,991,607 Y422F probably benign Het
Prdm16 A G 4: 154,320,882 L1245P probably damaging Het
Prob1 G A 18: 35,653,551 A550V probably benign Het
Prok1 T C 3: 107,237,092 H65R probably benign Het
Ptcd1 A G 5: 145,155,077 V404A probably benign Het
Sbf2 T C 7: 110,315,082 E1631G probably benign Het
Sdad1 C A 5: 92,300,089 K262N probably benign Het
Sh3bp1 G T 15: 78,910,072 A547S probably benign Het
Sptb T C 12: 76,628,559 D227G probably benign Het
Tbx1 A G 16: 18,588,019 M1T probably null Het
Tespa1 T A 10: 130,347,339 V51D probably damaging Het
Tmc7 T C 7: 118,566,245 N82S probably benign Het
Tmem8b A G 4: 43,689,476 D290G possibly damaging Het
Trbv13-2 A T 6: 41,121,559 T23S probably damaging Het
Trib3 A T 2: 152,338,633 D213E probably damaging Het
Tubgcp4 T C 2: 121,183,500 V178A probably benign Het
Virma T A 4: 11,539,918 C1412* probably null Het
Vmn2r108 T C 17: 20,471,500 T254A probably benign Het
Vps13d A G 4: 145,155,567 V1152A Het
Wdr47 T C 3: 108,618,968 V269A probably damaging Het
Zc3h13 T A 14: 75,324,537 D676E unknown Het
Zc3h6 T A 2: 129,017,014 S988R probably benign Het
Other mutations in Il3ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02454:Il3ra APN 14 14351113 missense probably benign 0.36
IGL02547:Il3ra APN 14 14351970 missense probably benign 0.01
IGL02550:Il3ra APN 14 14348055 missense probably benign 0.03
IGL02632:Il3ra APN 14 14350807 critical splice donor site probably null
IGL02737:Il3ra APN 14 14350760 missense probably benign 0.02
R0165:Il3ra UTSW 14 14350967 missense probably benign 0.01
R0597:Il3ra UTSW 14 14351166 critical splice donor site probably null
R1109:Il3ra UTSW 14 14349317 missense probably damaging 1.00
R2211:Il3ra UTSW 14 14355029 missense probably benign 0.03
R2409:Il3ra UTSW 14 14349377 splice site probably null
R4258:Il3ra UTSW 14 14347961 missense probably damaging 1.00
R4896:Il3ra UTSW 14 14355381 missense probably benign 0.07
R4994:Il3ra UTSW 14 14351080 missense probably benign 0.19
R5004:Il3ra UTSW 14 14355381 missense probably benign 0.07
R5935:Il3ra UTSW 14 14350799 missense probably damaging 0.99
R6274:Il3ra UTSW 14 14350180 missense probably benign 0.19
R6350:Il3ra UTSW 14 14348903 missense probably benign 0.07
R6403:Il3ra UTSW 14 14347137 missense probably damaging 0.98
R6845:Il3ra UTSW 14 14346517 splice site probably null
R7417:Il3ra UTSW 14 14349345 missense probably benign 0.08
R7432:Il3ra UTSW 14 14350691 missense possibly damaging 0.64
R7450:Il3ra UTSW 14 14351090 missense probably benign 0.25
Z1088:Il3ra UTSW 14 14351129 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCAAAGCCCATGATCAGG -3'
(R):5'- ATGGGATCAGAGGTCACACC -3'

Sequencing Primer
(F):5'- ATGCAAATTAGTGCTGGCCC -3'
(R):5'- CTGGCATCATAGGGTCACAGCTAG -3'
Posted On2020-01-23