Incidental Mutation 'R8048:Fam227a'
ID618898
Institutional Source Beutler Lab
Gene Symbol Fam227a
Ensembl Gene ENSMUSG00000042564
Gene Namefamily with sequence similarity 227, member A
Synonyms4933432B09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8048 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location79609576-79658956 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) CATTGTCTTGA to CA at 79649758 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109646] [ENSMUST00000109648] [ENSMUST00000187519] [ENSMUST00000191401] [ENSMUST00000229064] [ENSMUST00000230366]
Predicted Effect probably benign
Transcript: ENSMUST00000109646
SMART Domains Protein: ENSMUSP00000105273
Gene: ENSMUSG00000042564

DomainStartEndE-ValueType
low complexity region 156 175 N/A INTRINSIC
low complexity region 204 211 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109648
SMART Domains Protein: ENSMUSP00000105275
Gene: ENSMUSG00000042564

DomainStartEndE-ValueType
Pfam:FWWh 134 295 1.4e-51 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187519
SMART Domains Protein: ENSMUSP00000139524
Gene: ENSMUSG00000042564

DomainStartEndE-ValueType
Pfam:FWWh 132 295 1e-47 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191401
Predicted Effect probably null
Transcript: ENSMUST00000229064
Predicted Effect probably null
Transcript: ENSMUST00000230366
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,410,844 L318F probably damaging Het
Alms1 T A 6: 85,641,334 S2318R probably benign Het
Arhgap12 G A 18: 6,052,883 T443I probably benign Het
Arhgap29 C T 3: 121,992,901 R372W probably damaging Het
Astn1 T C 1: 158,688,638 I1266T probably benign Het
Bsg T C 10: 79,709,746 V164A probably benign Het
C1qa G T 4: 136,896,610 S94R probably benign Het
Cadps2 A G 6: 23,838,863 V92A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc187 T A 2: 26,293,514 D158V possibly damaging Het
Cngb1 T A 8: 95,263,210 Y758F possibly damaging Het
Ddx4 G A 13: 112,622,172 A285V probably null Het
Dsg1c A T 18: 20,274,767 K390M probably damaging Het
Dst T C 1: 34,190,636 F2437L probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fez2 T C 17: 78,387,053 I303V probably benign Het
Ffar1 A T 7: 30,860,578 I298N probably benign Het
Hpx C T 7: 105,595,478 V228I probably benign Het
Igkv1-117 T G 6: 68,121,802 C112G probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Ivl T A 3: 92,571,924 K278M probably damaging Het
Lyst A G 13: 13,687,645 T2589A probably benign Het
Madd A T 2: 91,154,448 M1359K probably damaging Het
Nav3 T C 10: 109,764,918 T1283A probably benign Het
Ncapd2 G T 6: 125,179,698 C439* probably null Het
Nebl T C 2: 17,424,522 D266G probably benign Het
Oas1f G T 5: 120,847,537 G49V probably damaging Het
Oas1f A T 5: 120,848,416 Q144L possibly damaging Het
Olfr1032 T G 2: 86,008,180 S135A probably damaging Het
Olfr1052 C T 2: 86,298,328 P171S probably benign Het
Olfr1062 T A 2: 86,423,307 Y123F probably damaging Het
Olfr134 T C 17: 38,175,528 V148A probably benign Het
Olfr141 T A 2: 86,806,171 Y276F probably damaging Het
Olfr1440 A G 19: 12,394,355 I31V not run Het
Olfr324 A G 11: 58,597,407 I6V unknown Het
Olfr711 C T 7: 106,972,464 probably benign Het
Olfr740 T C 14: 50,453,916 L288P possibly damaging Het
Olfr917 C T 9: 38,665,812 E11K probably benign Het
Pard3b T A 1: 62,153,989 V217E probably damaging Het
Pcdha2 T A 18: 36,939,460 I48N probably damaging Het
Pi4ka A G 16: 17,303,127 F1248L Het
Plpp4 C T 7: 129,379,477 R151C unknown Het
Pramef17 T A 4: 143,991,607 Y422F probably benign Het
Prdm16 A G 4: 154,320,882 L1245P probably damaging Het
Prob1 G A 18: 35,653,551 A550V probably benign Het
Prok1 T C 3: 107,237,092 H65R probably benign Het
Ptcd1 A G 5: 145,155,077 V404A probably benign Het
Sbf2 T C 7: 110,315,082 E1631G probably benign Het
Sdad1 C A 5: 92,300,089 K262N probably benign Het
Sh3bp1 G T 15: 78,910,072 A547S probably benign Het
Sptb T C 12: 76,628,559 D227G probably benign Het
Tbx1 A G 16: 18,588,019 M1T probably null Het
Tespa1 T A 10: 130,347,339 V51D probably damaging Het
Tmc7 T C 7: 118,566,245 N82S probably benign Het
Tmem8b A G 4: 43,689,476 D290G possibly damaging Het
Trbv13-2 A T 6: 41,121,559 T23S probably damaging Het
Trib3 A T 2: 152,338,633 D213E probably damaging Het
Tubgcp4 T C 2: 121,183,500 V178A probably benign Het
Virma T A 4: 11,539,918 C1412* probably null Het
Vmn2r108 T C 17: 20,471,500 T254A probably benign Het
Vps13d A G 4: 145,155,567 V1152A Het
Wdr47 T C 3: 108,618,968 V269A probably damaging Het
Zc3h13 T A 14: 75,324,537 D676E unknown Het
Zc3h6 T A 2: 129,017,014 S988R probably benign Het
Other mutations in Fam227a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Fam227a APN 15 79634073 missense possibly damaging 0.66
IGL01807:Fam227a APN 15 79649655 missense probably benign 0.03
IGL01936:Fam227a APN 15 79612546 missense possibly damaging 0.90
IGL02355:Fam227a APN 15 79643938 intron probably benign
IGL02362:Fam227a APN 15 79643938 intron probably benign
IGL02569:Fam227a APN 15 79634122 missense probably benign
IGL02713:Fam227a APN 15 79636796 splice site probably benign
IGL02734:Fam227a APN 15 79617841 splice site probably benign
IGL02816:Fam227a APN 15 79626296 missense possibly damaging 0.66
IGL03354:Fam227a APN 15 79636750 missense possibly damaging 0.91
R0105:Fam227a UTSW 15 79620832 missense possibly damaging 0.90
R0194:Fam227a UTSW 15 79640669 nonsense probably null
R0437:Fam227a UTSW 15 79643988 missense possibly damaging 0.90
R0786:Fam227a UTSW 15 79626268 missense probably benign 0.01
R0925:Fam227a UTSW 15 79620805 missense probably benign 0.04
R1200:Fam227a UTSW 15 79612537 missense possibly damaging 0.66
R1424:Fam227a UTSW 15 79634108 missense probably benign 0.34
R1474:Fam227a UTSW 15 79615381 missense probably damaging 0.97
R1495:Fam227a UTSW 15 79626245 missense probably benign 0.00
R1561:Fam227a UTSW 15 79636762 missense possibly damaging 0.95
R1661:Fam227a UTSW 15 79620677 intron probably null
R1669:Fam227a UTSW 15 79620677 intron probably null
R1967:Fam227a UTSW 15 79637134 missense possibly damaging 0.93
R1976:Fam227a UTSW 15 79626276 missense possibly damaging 0.83
R2197:Fam227a UTSW 15 79623467 missense probably damaging 0.97
R2230:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2231:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2232:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2910:Fam227a UTSW 15 79636734 missense possibly damaging 0.81
R3027:Fam227a UTSW 15 79648733 splice site probably null
R3943:Fam227a UTSW 15 79620859 splice site probably benign
R4811:Fam227a UTSW 15 79615427 missense possibly damaging 0.66
R4845:Fam227a UTSW 15 79649711 missense probably damaging 0.99
R4896:Fam227a UTSW 15 79637054 missense probably benign 0.32
R4934:Fam227a UTSW 15 79637061 missense possibly damaging 0.71
R4941:Fam227a UTSW 15 79640003 critical splice donor site probably null
R5225:Fam227a UTSW 15 79636735 missense possibly damaging 0.90
R5369:Fam227a UTSW 15 79615436 missense probably benign 0.27
R5593:Fam227a UTSW 15 79640058 utr 3 prime probably benign
R6311:Fam227a UTSW 15 79640694 missense probably benign 0.23
R6362:Fam227a UTSW 15 79643350 missense possibly damaging 0.53
R6532:Fam227a UTSW 15 79636720 missense probably benign 0.00
R7239:Fam227a UTSW 15 79634062 critical splice donor site probably null
R7619:Fam227a UTSW 15 79617766 missense probably benign
R7719:Fam227a UTSW 15 79620712 missense possibly damaging 0.53
R8006:Fam227a UTSW 15 79634098 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTGTAGAGTGGGCTCACAGATG -3'
(R):5'- TTAGAGTCCAGATCAGCAGGC -3'

Sequencing Primer
(F):5'- TAAGCACTCATTGTAGCGCG -3'
(R):5'- AGTCCAGATCAGCAGGCTGTTG -3'
Posted On2020-01-23