Incidental Mutation 'R8048:Prob1'
ID618907
Institutional Source Beutler Lab
Gene Symbol Prob1
Ensembl Gene ENSMUSG00000073600
Gene Nameproline rich basic protein 1
SynonymsLOC381148, Gm1614
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R8048 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location35650351-35655238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35653551 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 550 (A550V)
Ref Sequence ENSEMBL: ENSMUSP00000140465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025209] [ENSMUST00000025211] [ENSMUST00000097619] [ENSMUST00000190196]
Predicted Effect probably benign
Transcript: ENSMUST00000025209
SMART Domains Protein: ENSMUSP00000025209
Gene: ENSMUSG00000024352

DomainStartEndE-ValueType
Pfam:SPATA24 10 191 1.5e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025211
SMART Domains Protein: ENSMUSP00000025211
Gene: ENSMUSG00000024353

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF3456 48 177 5.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097619
AA Change: A546V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000095224
Gene: ENSMUSG00000073600
AA Change: A546V

DomainStartEndE-ValueType
low complexity region 78 102 N/A INTRINSIC
low complexity region 142 155 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 536 553 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
Pfam:DUF4585 862 931 4.6e-27 PFAM
low complexity region 989 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190196
AA Change: A550V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140465
Gene: ENSMUSG00000073600
AA Change: A550V

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
low complexity region 146 159 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
low complexity region 381 400 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 833 852 N/A INTRINSIC
Pfam:DUF4585 864 936 7.5e-27 PFAM
low complexity region 993 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,410,844 L318F probably damaging Het
Alms1 T A 6: 85,641,334 S2318R probably benign Het
Arhgap12 G A 18: 6,052,883 T443I probably benign Het
Arhgap29 C T 3: 121,992,901 R372W probably damaging Het
Astn1 T C 1: 158,688,638 I1266T probably benign Het
Bsg T C 10: 79,709,746 V164A probably benign Het
C1qa G T 4: 136,896,610 S94R probably benign Het
Cadps2 A G 6: 23,838,863 V92A probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc187 T A 2: 26,293,514 D158V possibly damaging Het
Cngb1 T A 8: 95,263,210 Y758F possibly damaging Het
Ddx4 G A 13: 112,622,172 A285V probably null Het
Dsg1c A T 18: 20,274,767 K390M probably damaging Het
Dst T C 1: 34,190,636 F2437L probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam227a CATTGTCTTGA CA 15: 79,649,758 probably null Het
Fez2 T C 17: 78,387,053 I303V probably benign Het
Ffar1 A T 7: 30,860,578 I298N probably benign Het
Hpx C T 7: 105,595,478 V228I probably benign Het
Igkv1-117 T G 6: 68,121,802 C112G probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Ivl T A 3: 92,571,924 K278M probably damaging Het
Lyst A G 13: 13,687,645 T2589A probably benign Het
Madd A T 2: 91,154,448 M1359K probably damaging Het
Nav3 T C 10: 109,764,918 T1283A probably benign Het
Ncapd2 G T 6: 125,179,698 C439* probably null Het
Nebl T C 2: 17,424,522 D266G probably benign Het
Oas1f G T 5: 120,847,537 G49V probably damaging Het
Oas1f A T 5: 120,848,416 Q144L possibly damaging Het
Olfr1032 T G 2: 86,008,180 S135A probably damaging Het
Olfr1052 C T 2: 86,298,328 P171S probably benign Het
Olfr1062 T A 2: 86,423,307 Y123F probably damaging Het
Olfr134 T C 17: 38,175,528 V148A probably benign Het
Olfr141 T A 2: 86,806,171 Y276F probably damaging Het
Olfr1440 A G 19: 12,394,355 I31V not run Het
Olfr324 A G 11: 58,597,407 I6V unknown Het
Olfr711 C T 7: 106,972,464 probably benign Het
Olfr740 T C 14: 50,453,916 L288P possibly damaging Het
Olfr917 C T 9: 38,665,812 E11K probably benign Het
Pard3b T A 1: 62,153,989 V217E probably damaging Het
Pcdha2 T A 18: 36,939,460 I48N probably damaging Het
Pi4ka A G 16: 17,303,127 F1248L Het
Plpp4 C T 7: 129,379,477 R151C unknown Het
Pramef17 T A 4: 143,991,607 Y422F probably benign Het
Prdm16 A G 4: 154,320,882 L1245P probably damaging Het
Prok1 T C 3: 107,237,092 H65R probably benign Het
Ptcd1 A G 5: 145,155,077 V404A probably benign Het
Sbf2 T C 7: 110,315,082 E1631G probably benign Het
Sdad1 C A 5: 92,300,089 K262N probably benign Het
Sh3bp1 G T 15: 78,910,072 A547S probably benign Het
Sptb T C 12: 76,628,559 D227G probably benign Het
Tbx1 A G 16: 18,588,019 M1T probably null Het
Tespa1 T A 10: 130,347,339 V51D probably damaging Het
Tmc7 T C 7: 118,566,245 N82S probably benign Het
Tmem8b A G 4: 43,689,476 D290G possibly damaging Het
Trbv13-2 A T 6: 41,121,559 T23S probably damaging Het
Trib3 A T 2: 152,338,633 D213E probably damaging Het
Tubgcp4 T C 2: 121,183,500 V178A probably benign Het
Virma T A 4: 11,539,918 C1412* probably null Het
Vmn2r108 T C 17: 20,471,500 T254A probably benign Het
Vps13d A G 4: 145,155,567 V1152A Het
Wdr47 T C 3: 108,618,968 V269A probably damaging Het
Zc3h13 T A 14: 75,324,537 D676E unknown Het
Zc3h6 T A 2: 129,017,014 S988R probably benign Het
Other mutations in Prob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Prob1 APN 18 35653333 missense possibly damaging 0.91
IGL02352:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02359:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02823:Prob1 APN 18 35652747 missense possibly damaging 0.86
IGL03003:Prob1 APN 18 35653375 missense possibly damaging 0.73
IGL03390:Prob1 APN 18 35654139 missense probably benign 0.03
R0257:Prob1 UTSW 18 35653039 missense possibly damaging 0.53
R0421:Prob1 UTSW 18 35653030 missense possibly damaging 0.70
R0457:Prob1 UTSW 18 35652486 missense probably damaging 0.98
R0485:Prob1 UTSW 18 35653825 missense possibly damaging 0.53
R0575:Prob1 UTSW 18 35654721 missense possibly damaging 0.85
R1056:Prob1 UTSW 18 35653610 missense probably benign
R1147:Prob1 UTSW 18 35654806 nonsense probably null
R1334:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1727:Prob1 UTSW 18 35654311 missense possibly damaging 0.73
R1753:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1826:Prob1 UTSW 18 35653575 missense possibly damaging 0.72
R1895:Prob1 UTSW 18 35652889 missense possibly damaging 0.53
R1937:Prob1 UTSW 18 35654226 missense possibly damaging 0.53
R2170:Prob1 UTSW 18 35654737 missense probably benign 0.18
R3435:Prob1 UTSW 18 35654241 missense possibly damaging 0.72
R4749:Prob1 UTSW 18 35652816 missense possibly damaging 0.91
R4968:Prob1 UTSW 18 35652552 missense probably damaging 0.98
R5107:Prob1 UTSW 18 35652936 missense possibly damaging 0.53
R5602:Prob1 UTSW 18 35654026 missense possibly damaging 0.96
R5646:Prob1 UTSW 18 35654114 missense probably benign 0.18
R6035:Prob1 UTSW 18 35654782 missense probably benign 0.18
R6747:Prob1 UTSW 18 35655154 missense probably damaging 0.97
R6954:Prob1 UTSW 18 35654268 missense probably benign
R7061:Prob1 UTSW 18 35654500 missense probably benign 0.18
R7292:Prob1 UTSW 18 35654550 missense possibly damaging 0.93
R7296:Prob1 UTSW 18 35653299 missense possibly damaging 0.53
R7566:Prob1 UTSW 18 35654985 missense probably benign 0.33
R7723:Prob1 UTSW 18 35652889 missense possibly damaging 0.53
R7787:Prob1 UTSW 18 35652232 missense possibly damaging 0.73
R7798:Prob1 UTSW 18 35653344 missense possibly damaging 0.93
X0067:Prob1 UTSW 18 35653091 missense possibly damaging 0.70
Z1088:Prob1 UTSW 18 35652769 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TAACCATCTTGCGCACGTC -3'
(R):5'- AGGTTCCGAATTCGAGAGGC -3'

Sequencing Primer
(F):5'- GCGTTCAGAAGCCGCTTCTC -3'
(R):5'- TTCGAGAGGCGGAGATGC -3'
Posted On2020-01-23