Incidental Mutation 'R8049:C3ar1'
ID618929
Institutional Source Beutler Lab
Gene Symbol C3ar1
Ensembl Gene ENSMUSG00000040552
Gene Namecomplement component 3a receptor 1
SynonymsC3aR, anaphylatoxin C3a receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8049 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location122847138-122856161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122850100 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 386 (Y386F)
Ref Sequence ENSEMBL: ENSMUSP00000048092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003238] [ENSMUST00000042081] [ENSMUST00000177927]
Predicted Effect probably benign
Transcript: ENSMUST00000003238
SMART Domains Protein: ENSMUSP00000003238
Gene: ENSMUSG00000003154

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000042081
AA Change: Y386F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552
AA Change: Y386F

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177927
SMART Domains Protein: ENSMUSP00000137645
Gene: ENSMUSG00000003154

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous targeted mutants display protective effects against the changes in lung physiology after allergen challenge, increased lethality to endotoxin shock, and elevated IL1B following LPS challenge, supporting the role of C3arin proinflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,104 T69S probably benign Het
2310050C09Rik A T 3: 92,868,895 Y160* probably null Het
2610044O15Rik8 A T 8: 129,220,074 L90H probably damaging Het
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
3632451O06Rik G T 14: 49,773,536 A238E probably damaging Het
5730455P16Rik A G 11: 80,377,972 S4P possibly damaging Het
Abca13 T A 11: 9,291,867 N1243K probably damaging Het
Adgrg6 A T 10: 14,428,199 S824T probably benign Het
Cdc14a T C 3: 116,293,928 N527S probably benign Het
Col7a1 C T 9: 108,975,563 P2279S unknown Het
Crb2 G A 2: 37,793,240 G918D probably benign Het
Dcn C A 10: 97,513,617 N250K probably damaging Het
Ddx55 T C 5: 124,556,758 V83A probably damaging Het
Dnaja2 T A 8: 85,539,247 H403L possibly damaging Het
Dpy19l4 T C 4: 11,303,982 I143V probably benign Het
Efna5 G T 17: 62,650,982 T93K probably benign Het
Eml6 A G 11: 29,893,201 V171A possibly damaging Het
Esyt1 C G 10: 128,512,086 V942L probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam78a C A 2: 32,083,023 probably benign Het
Fat2 A G 11: 55,312,066 Y61H probably benign Het
Fbxw14 A T 9: 109,276,143 M318K probably damaging Het
Gm14295 A G 2: 176,809,078 I120M probably benign Het
Gm14403 T A 2: 177,508,518 Y86N probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr55 T C 1: 85,941,697 D54G probably benign Het
Gtf2b T G 3: 142,778,214 S50A probably damaging Het
Ifit3 A T 19: 34,588,080 E342V possibly damaging Het
Iqgap3 T A 3: 88,104,302 I798N probably damaging Het
Lpin1 T C 12: 16,563,684 D494G Het
Lsm12 T C 11: 102,165,409 E149G possibly damaging Het
Mtfr2 T C 10: 20,352,857 S50P possibly damaging Het
Ndnf T C 6: 65,703,430 M231T probably benign Het
Noc3l A T 19: 38,812,429 V203E probably benign Het
Olfr368 A T 2: 37,332,334 T196S probably damaging Het
Olfr387-ps1 G T 11: 73,665,162 K184N possibly damaging Het
Olfr649 C A 7: 104,189,810 L132F probably damaging Het
Olfr824 A T 10: 130,126,600 Y152* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde6b C T 5: 108,425,252 P496L probably benign Het
Plppr1 A T 4: 49,300,942 M92L probably benign Het
Ptprk C G 10: 28,383,569 S335C possibly damaging Het
Rars2 T A 4: 34,650,217 M334K probably benign Het
Rasl10a A T 11: 5,059,823 I124F probably damaging Het
Rgs12 T A 5: 35,026,030 V1007E possibly damaging Het
Rnf122 T A 8: 31,128,580 C119S probably damaging Het
Scn11a T A 9: 119,755,083 I1489F probably damaging Het
Setd6 C A 8: 95,716,688 S186R probably benign Het
Tex19.1 A G 11: 121,147,322 T169A probably benign Het
Th G A 7: 142,894,123 P408S probably damaging Het
Trappc13 T C 13: 104,144,544 M337V probably benign Het
Treml2 A T 17: 48,302,734 K65* probably null Het
Ubxn4 T C 1: 128,256,196 S98P probably damaging Het
Wrnip1 A G 13: 32,821,977 S601G probably benign Het
Other mutations in C3ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:C3ar1 APN 6 122850419 missense probably benign 0.00
IGL01936:C3ar1 APN 6 122851235 missense probably benign 0.04
IGL01998:C3ar1 APN 6 122850940 missense probably damaging 1.00
IGL02351:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02358:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02399:C3ar1 APN 6 122849879 missense probably benign 0.00
PIT4618001:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0014:C3ar1 UTSW 6 122850851 missense probably damaging 1.00
R0195:C3ar1 UTSW 6 122851155 missense possibly damaging 0.95
R0257:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0344:C3ar1 UTSW 6 122850772 missense probably benign 0.45
R4345:C3ar1 UTSW 6 122850700 missense probably damaging 1.00
R4614:C3ar1 UTSW 6 122850721 missense probably benign 0.00
R4643:C3ar1 UTSW 6 122850974 missense probably damaging 1.00
R4840:C3ar1 UTSW 6 122850764 missense probably benign
R5235:C3ar1 UTSW 6 122850922 missense probably damaging 1.00
R5303:C3ar1 UTSW 6 122849835 missense probably damaging 1.00
R5610:C3ar1 UTSW 6 122850578 missense probably benign 0.01
R5762:C3ar1 UTSW 6 122850362 missense probably benign 0.07
R5873:C3ar1 UTSW 6 122850422 missense probably benign 0.24
R5877:C3ar1 UTSW 6 122850622 missense probably benign 0.17
R6327:C3ar1 UTSW 6 122850146 missense probably damaging 1.00
R6440:C3ar1 UTSW 6 122850508 missense probably damaging 0.99
R6505:C3ar1 UTSW 6 122850640 missense probably benign 0.03
R6636:C3ar1 UTSW 6 122851054 missense probably damaging 1.00
R6755:C3ar1 UTSW 6 122849858 missense probably benign 0.00
R6953:C3ar1 UTSW 6 122850632 missense possibly damaging 0.49
X0065:C3ar1 UTSW 6 122850765 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGGCTGCTTCCAGAATGC -3'
(R):5'- TGACAATCATGTGCCGACACC -3'

Sequencing Primer
(F):5'- TCCAGAATGCCCTTTATAGACTG -3'
(R):5'- GACACCGCTGATGGCAATAAC -3'
Posted On2020-01-23