Incidental Mutation 'R8049:Scn11a'
ID 618938
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 067486-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8049 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119584149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1489 (I1489F)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: I1489F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: I1489F

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: I1489F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,555,992 (GRCm39) T69S probably benign Het
5730455P16Rik A G 11: 80,268,798 (GRCm39) S4P possibly damaging Het
Abca13 T A 11: 9,241,867 (GRCm39) N1243K probably damaging Het
Adgrg6 A T 10: 14,303,943 (GRCm39) S824T probably benign Het
Armh4 G T 14: 50,010,993 (GRCm39) A238E probably damaging Het
C3ar1 T A 6: 122,827,059 (GRCm39) Y386F probably damaging Het
Cdc14a T C 3: 116,087,577 (GRCm39) N527S probably benign Het
Cfap69 A T 5: 5,669,085 (GRCm39) probably benign Het
Col7a1 C T 9: 108,804,631 (GRCm39) P2279S unknown Het
Crb2 G A 2: 37,683,252 (GRCm39) G918D probably benign Het
Dcn C A 10: 97,349,479 (GRCm39) N250K probably damaging Het
Dctn5 G A 7: 121,732,466 (GRCm39) probably benign Het
Ddx55 T C 5: 124,694,821 (GRCm39) V83A probably damaging Het
Dnaja2 T A 8: 86,265,876 (GRCm39) H403L possibly damaging Het
Dpy19l4 T C 4: 11,303,982 (GRCm39) I143V probably benign Het
Efna5 G T 17: 62,957,977 (GRCm39) T93K probably benign Het
Eml6 A G 11: 29,843,201 (GRCm39) V171A possibly damaging Het
Esyt1 C G 10: 128,347,955 (GRCm39) V942L probably benign Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam78a C A 2: 31,973,035 (GRCm39) probably benign Het
Fat2 A G 11: 55,202,892 (GRCm39) Y61H probably benign Het
Fbxw14 A T 9: 109,105,211 (GRCm39) M318K probably damaging Het
Gm14295 A G 2: 176,500,871 (GRCm39) I120M probably benign Het
Gm14403 T A 2: 177,200,311 (GRCm39) Y86N probably benign Het
Gmcl1 G T 6: 86,698,408 (GRCm39) A163E probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr55 T C 1: 85,869,419 (GRCm39) D54G probably benign Het
Gtf2b T G 3: 142,483,975 (GRCm39) S50A probably damaging Het
Ifit3 A T 19: 34,565,480 (GRCm39) E342V possibly damaging Het
Iqgap3 T A 3: 88,011,609 (GRCm39) I798N probably damaging Het
Kplce A T 3: 92,776,202 (GRCm39) Y160* probably null Het
Lpin1 T C 12: 16,613,685 (GRCm39) D494G Het
Lsm12 T C 11: 102,056,235 (GRCm39) E149G possibly damaging Het
Mtfr2 T C 10: 20,228,603 (GRCm39) S50P possibly damaging Het
Ndnf T C 6: 65,680,414 (GRCm39) M231T probably benign Het
Noc3l A T 19: 38,800,873 (GRCm39) V203E probably benign Het
Or1e27-ps1 G T 11: 73,555,988 (GRCm39) K184N possibly damaging Het
Or52h2 C A 7: 103,839,017 (GRCm39) L132F probably damaging Het
Or5c1 A T 2: 37,222,346 (GRCm39) T196S probably damaging Het
Or9r7 A T 10: 129,962,469 (GRCm39) Y152* probably null Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pde6b C T 5: 108,573,118 (GRCm39) P496L probably benign Het
Plppr1 A T 4: 49,300,942 (GRCm39) M92L probably benign Het
Pphln1-ps1 C T 16: 13,495,623 (GRCm39) R241C probably damaging Het
Ptprk C G 10: 28,259,565 (GRCm39) S335C possibly damaging Het
Rars2 T A 4: 34,650,217 (GRCm39) M334K probably benign Het
Rasl10a A T 11: 5,009,823 (GRCm39) I124F probably damaging Het
Rgs12 T A 5: 35,183,374 (GRCm39) V1007E possibly damaging Het
Rnf122 T A 8: 31,618,608 (GRCm39) C119S probably damaging Het
Setd6 C A 8: 96,443,316 (GRCm39) S186R probably benign Het
Tex19.1 A G 11: 121,038,148 (GRCm39) T169A probably benign Het
Th G A 7: 142,447,860 (GRCm39) P408S probably damaging Het
Trappc13 T C 13: 104,281,052 (GRCm39) M337V probably benign Het
Treml2 A T 17: 48,609,762 (GRCm39) K65* probably null Het
Ubxn4 T C 1: 128,183,933 (GRCm39) S98P probably damaging Het
Wrnip1 A G 13: 33,005,960 (GRCm39) S601G probably benign Het
Zfp1006 A T 8: 129,946,555 (GRCm39) L90H probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTTTTGATTCCAGCATGGG -3'
(R):5'- GCAGTGCATGTTGGGAACTC -3'

Sequencing Primer
(F):5'- ATTCCAGCATGGGGTTGAG -3'
(R):5'- TTTCTGGCTTGGAGAACAGCAAC -3'
Posted On 2020-01-23