Incidental Mutation 'R0662:Olfr703'
ID61894
Institutional Source Beutler Lab
Gene Symbol Olfr703
Ensembl Gene ENSMUSG00000073901
Gene Nameolfactory receptor 703
SynonymsMOR283-7, GA_x6K02T2PBJ9-9222217-9223176
MMRRC Submission 038847-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R0662 (G1)
Quality Score133
Status Not validated
Chromosome7
Chromosomal Location106843360-106846207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106844649 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 13 (I13F)
Ref Sequence ENSEMBL: ENSMUSP00000149022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098142] [ENSMUST00000216254]
Predicted Effect probably benign
Transcript: ENSMUST00000098142
AA Change: I13F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000095746
Gene: ENSMUSG00000073901
AA Change: I13F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.4e-8 PFAM
Pfam:7tm_1 41 290 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216254
AA Change: I13F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,938 S241P probably benign Het
Ankrd53 G T 6: 83,763,643 V83L probably damaging Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
C4b G A 17: 34,730,888 R1441C probably damaging Het
Cacng3 T C 7: 122,768,359 I154T probably damaging Het
Cand2 A G 6: 115,787,210 D315G probably benign Het
Celsr2 A T 3: 108,398,520 S2089R probably damaging Het
Chd9 A C 8: 90,977,676 K247Q probably damaging Het
Chil1 A C 1: 134,188,573 S263R probably damaging Het
Clec12b A C 6: 129,376,237 C262W probably damaging Het
Cpsf7 T C 19: 10,526,008 M1T probably null Het
Cul3 T C 1: 80,271,565 D597G probably damaging Het
Dcaf11 T C 14: 55,565,507 V251A possibly damaging Het
Eno2 A T 6: 124,763,811 F218I probably damaging Het
Frmd6 A T 12: 70,899,444 R549* probably null Het
Fyb2 G A 4: 104,995,698 S461N possibly damaging Het
Gm5709 A T 3: 59,606,743 noncoding transcript Het
Hormad1 T C 3: 95,575,599 I132T probably benign Het
Itga7 G T 10: 128,953,531 R981L probably damaging Het
Itgbl1 T A 14: 123,827,894 N153K probably damaging Het
Itih1 T C 14: 30,933,360 E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcna2 A T 3: 107,105,401 T433S probably benign Het
Map4k5 A G 12: 69,813,153 V673A probably damaging Het
Mmp27 T A 9: 7,577,650 V281E probably benign Het
Nr2c1 A T 10: 94,190,738 I492F probably damaging Het
Olfr131 A G 17: 38,082,933 I15T probably benign Het
Olfr292 A G 7: 86,694,630 Y58C possibly damaging Het
Olfr457 C T 6: 42,471,774 V135M possibly damaging Het
Olfr77 G C 9: 19,920,500 C97S probably damaging Het
Olfr862 T C 9: 19,883,952 M118V probably benign Het
Olfr911-ps1 T A 9: 38,524,026 M98K probably damaging Het
Pank3 T C 11: 35,778,650 M237T probably damaging Het
Plekhh1 A G 12: 79,078,993 T1268A probably benign Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Rhcg C T 7: 79,599,729 V310M probably damaging Het
Ryr1 A T 7: 29,100,189 D906E probably damaging Het
Sez6l A T 5: 112,473,422 L262Q probably damaging Het
Shprh G A 10: 11,186,847 V1233I probably damaging Het
Slc3a1 A G 17: 85,037,207 E267G possibly damaging Het
Slc5a5 T A 8: 70,883,875 T616S probably benign Het
St5 G T 7: 109,557,426 P39Q probably damaging Het
Syne3 T G 12: 104,961,510 E318A probably benign Het
Tecpr2 A G 12: 110,896,228 T25A probably benign Het
Ubxn1 T A 19: 8,875,197 probably null Het
Unc5b C A 10: 60,772,583 R616L possibly damaging Het
Ush2a A G 1: 188,351,093 T278A probably benign Het
Utp14b A G 1: 78,664,999 T205A probably damaging Het
Vmn1r219 T C 13: 23,163,453 S271P possibly damaging Het
Vmn2r76 C T 7: 86,230,370 V241M probably benign Het
Zbtb24 G A 10: 41,462,279 G429D probably damaging Het
Zdhhc2 T C 8: 40,447,098 S68P probably damaging Het
Zfp719 G A 7: 43,584,254 M32I possibly damaging Het
Zfp975 T C 7: 42,662,526 N221S probably benign Het
Other mutations in Olfr703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Olfr703 APN 7 106845367 missense possibly damaging 0.78
IGL01321:Olfr703 APN 7 106844749 missense probably damaging 1.00
IGL02169:Olfr703 APN 7 106845266 nonsense probably null
IGL03376:Olfr703 APN 7 106845470 missense probably damaging 1.00
R0045:Olfr703 UTSW 7 106845389 nonsense probably null
R1589:Olfr703 UTSW 7 106845196 missense possibly damaging 0.57
R1869:Olfr703 UTSW 7 106845094 missense probably benign 0.01
R2431:Olfr703 UTSW 7 106845391 missense possibly damaging 0.95
R4021:Olfr703 UTSW 7 106845019 missense probably damaging 1.00
R5280:Olfr703 UTSW 7 106844695 missense probably benign 0.01
R6352:Olfr703 UTSW 7 106845222 missense probably damaging 1.00
R6932:Olfr703 UTSW 7 106844802 nonsense probably null
R7037:Olfr703 UTSW 7 106845336 missense probably damaging 1.00
R7909:Olfr703 UTSW 7 106844992 missense probably benign 0.29
R7990:Olfr703 UTSW 7 106844992 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CATCTGGGAATGGTTGTACTGGGAC -3'
(R):5'- TCCAAGTAGGAGATACATGGGCACG -3'

Sequencing Primer
(F):5'- CTTGTAGTCTAGAGTTGAATACCTCC -3'
(R):5'- TACATGGGCACGCGGAG -3'
Posted On2013-07-30