Incidental Mutation 'R8049:Olfr824'
ID618945
Institutional Source Beutler Lab
Gene Symbol Olfr824
Ensembl Gene ENSMUSG00000095804
Gene Nameolfactory receptor 824
SynonymsGA_x6K02T2PULF-11797746-11796799, MOR210-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R8049 (G1)
Quality Score163.009
Status Validated
Chromosome10
Chromosomal Location130123470-130130000 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 130126600 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 152 (Y152*)
Ref Sequence ENSEMBL: ENSMUSP00000150606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074161] [ENSMUST00000214192] [ENSMUST00000215217]
Predicted Effect probably null
Transcript: ENSMUST00000074161
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000073794
Gene: ENSMUSG00000095804
AA Change: Y152*

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.6e-54 PFAM
Pfam:7tm_1 44 293 3e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214192
AA Change: Y152*
Predicted Effect probably null
Transcript: ENSMUST00000215217
AA Change: Y152*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,104 T69S probably benign Het
2310050C09Rik A T 3: 92,868,895 Y160* probably null Het
2610044O15Rik8 A T 8: 129,220,074 L90H probably damaging Het
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
3632451O06Rik G T 14: 49,773,536 A238E probably damaging Het
5730455P16Rik A G 11: 80,377,972 S4P possibly damaging Het
Abca13 T A 11: 9,291,867 N1243K probably damaging Het
Adgrg6 A T 10: 14,428,199 S824T probably benign Het
C3ar1 T A 6: 122,850,100 Y386F probably damaging Het
Cdc14a T C 3: 116,293,928 N527S probably benign Het
Cfap69 A T 5: 5,619,085 probably benign Het
Col7a1 C T 9: 108,975,563 P2279S unknown Het
Crb2 G A 2: 37,793,240 G918D probably benign Het
Dcn C A 10: 97,513,617 N250K probably damaging Het
Dctn5 G A 7: 122,133,243 probably benign Het
Ddx55 T C 5: 124,556,758 V83A probably damaging Het
Dnaja2 T A 8: 85,539,247 H403L possibly damaging Het
Dpy19l4 T C 4: 11,303,982 I143V probably benign Het
Efna5 G T 17: 62,650,982 T93K probably benign Het
Eml6 A G 11: 29,893,201 V171A possibly damaging Het
Esyt1 C G 10: 128,512,086 V942L probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam78a C A 2: 32,083,023 probably benign Het
Fat2 A G 11: 55,312,066 Y61H probably benign Het
Fbxw14 A T 9: 109,276,143 M318K probably damaging Het
Gm14295 A G 2: 176,809,078 I120M probably benign Het
Gm14403 T A 2: 177,508,518 Y86N probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr55 T C 1: 85,941,697 D54G probably benign Het
Gtf2b T G 3: 142,778,214 S50A probably damaging Het
Ifit3 A T 19: 34,588,080 E342V possibly damaging Het
Iqgap3 T A 3: 88,104,302 I798N probably damaging Het
Lpin1 T C 12: 16,563,684 D494G Het
Lsm12 T C 11: 102,165,409 E149G possibly damaging Het
Mtfr2 T C 10: 20,352,857 S50P possibly damaging Het
Ndnf T C 6: 65,703,430 M231T probably benign Het
Noc3l A T 19: 38,812,429 V203E probably benign Het
Olfr368 A T 2: 37,332,334 T196S probably damaging Het
Olfr387-ps1 G T 11: 73,665,162 K184N possibly damaging Het
Olfr649 C A 7: 104,189,810 L132F probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde6b C T 5: 108,425,252 P496L probably benign Het
Plppr1 A T 4: 49,300,942 M92L probably benign Het
Ptprk C G 10: 28,383,569 S335C possibly damaging Het
Rars2 T A 4: 34,650,217 M334K probably benign Het
Rasl10a A T 11: 5,059,823 I124F probably damaging Het
Rgs12 T A 5: 35,026,030 V1007E possibly damaging Het
Rnf122 T A 8: 31,128,580 C119S probably damaging Het
Scn11a T A 9: 119,755,083 I1489F probably damaging Het
Setd6 C A 8: 95,716,688 S186R probably benign Het
Tex19.1 A G 11: 121,147,322 T169A probably benign Het
Th G A 7: 142,894,123 P408S probably damaging Het
Trappc13 T C 13: 104,144,544 M337V probably benign Het
Treml2 A T 17: 48,302,734 K65* probably null Het
Ubxn4 T C 1: 128,256,196 S98P probably damaging Het
Wrnip1 A G 13: 32,821,977 S601G probably benign Het
Other mutations in Olfr824
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr824 APN 10 130126991 missense probably benign 0.45
IGL02391:Olfr824 APN 10 130126904 missense possibly damaging 0.75
IGL03247:Olfr824 APN 10 130126715 missense probably damaging 1.00
R0781:Olfr824 UTSW 10 130126653 missense probably damaging 1.00
R1110:Olfr824 UTSW 10 130126653 missense probably damaging 1.00
R1694:Olfr824 UTSW 10 130126254 missense possibly damaging 0.93
R2069:Olfr824 UTSW 10 130126205 missense possibly damaging 0.94
R2173:Olfr824 UTSW 10 130126503 missense probably benign 0.10
R4078:Olfr824 UTSW 10 130126718 missense probably damaging 1.00
R4864:Olfr824 UTSW 10 130126887 nonsense probably null
R5556:Olfr824 UTSW 10 130126859 missense probably damaging 1.00
R6704:Olfr824 UTSW 10 130126155 nonsense probably null
R7624:Olfr824 UTSW 10 130126586 missense probably damaging 0.98
R8013:Olfr824 UTSW 10 130126778 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGATCTTCAGGACAGTG -3'
(R):5'- ATTCCACAGTCATTGCACCC -3'

Sequencing Primer
(F):5'- TCTTCAGGACAGTGGAAAGGATG -3'
(R):5'- AACTCTAGCTACTATTTTCTCCAAGG -3'
Posted On2020-01-23