Incidental Mutation 'R0662:St5'
ID61895
Institutional Source Beutler Lab
Gene Symbol St5
Ensembl Gene ENSMUSG00000031024
Gene Namesuppression of tumorigenicity 5
Synonyms2610305K15Rik, 2010004M01Rik
MMRRC Submission 038847-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R0662 (G1)
Quality Score189
Status Not validated
Chromosome7
Chromosomal Location109523911-109703605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109557426 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 39 (P39Q)
Ref Sequence ENSEMBL: ENSMUSP00000146747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000207394] [ENSMUST00000207745] [ENSMUST00000208583]
Predicted Effect probably benign
Transcript: ENSMUST00000077909
AA Change: P39Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: P39Q

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079282
AA Change: P39Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: P39Q

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084738
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168005
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207394
AA Change: P39Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208557
Predicted Effect probably damaging
Transcript: ENSMUST00000208583
AA Change: P39Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208981
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,938 S241P probably benign Het
Ankrd53 G T 6: 83,763,643 V83L probably damaging Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
C4b G A 17: 34,730,888 R1441C probably damaging Het
Cacng3 T C 7: 122,768,359 I154T probably damaging Het
Cand2 A G 6: 115,787,210 D315G probably benign Het
Celsr2 A T 3: 108,398,520 S2089R probably damaging Het
Chd9 A C 8: 90,977,676 K247Q probably damaging Het
Chil1 A C 1: 134,188,573 S263R probably damaging Het
Clec12b A C 6: 129,376,237 C262W probably damaging Het
Cpsf7 T C 19: 10,526,008 M1T probably null Het
Cul3 T C 1: 80,271,565 D597G probably damaging Het
Dcaf11 T C 14: 55,565,507 V251A possibly damaging Het
Eno2 A T 6: 124,763,811 F218I probably damaging Het
Frmd6 A T 12: 70,899,444 R549* probably null Het
Fyb2 G A 4: 104,995,698 S461N possibly damaging Het
Gm5709 A T 3: 59,606,743 noncoding transcript Het
Hormad1 T C 3: 95,575,599 I132T probably benign Het
Itga7 G T 10: 128,953,531 R981L probably damaging Het
Itgbl1 T A 14: 123,827,894 N153K probably damaging Het
Itih1 T C 14: 30,933,360 E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcna2 A T 3: 107,105,401 T433S probably benign Het
Map4k5 A G 12: 69,813,153 V673A probably damaging Het
Mmp27 T A 9: 7,577,650 V281E probably benign Het
Nr2c1 A T 10: 94,190,738 I492F probably damaging Het
Olfr131 A G 17: 38,082,933 I15T probably benign Het
Olfr292 A G 7: 86,694,630 Y58C possibly damaging Het
Olfr457 C T 6: 42,471,774 V135M possibly damaging Het
Olfr703 A T 7: 106,844,649 I13F probably benign Het
Olfr77 G C 9: 19,920,500 C97S probably damaging Het
Olfr862 T C 9: 19,883,952 M118V probably benign Het
Olfr911-ps1 T A 9: 38,524,026 M98K probably damaging Het
Pank3 T C 11: 35,778,650 M237T probably damaging Het
Plekhh1 A G 12: 79,078,993 T1268A probably benign Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Rhcg C T 7: 79,599,729 V310M probably damaging Het
Ryr1 A T 7: 29,100,189 D906E probably damaging Het
Sez6l A T 5: 112,473,422 L262Q probably damaging Het
Shprh G A 10: 11,186,847 V1233I probably damaging Het
Slc3a1 A G 17: 85,037,207 E267G possibly damaging Het
Slc5a5 T A 8: 70,883,875 T616S probably benign Het
Syne3 T G 12: 104,961,510 E318A probably benign Het
Tecpr2 A G 12: 110,896,228 T25A probably benign Het
Ubxn1 T A 19: 8,875,197 probably null Het
Unc5b C A 10: 60,772,583 R616L possibly damaging Het
Ush2a A G 1: 188,351,093 T278A probably benign Het
Utp14b A G 1: 78,664,999 T205A probably damaging Het
Vmn1r219 T C 13: 23,163,453 S271P possibly damaging Het
Vmn2r76 C T 7: 86,230,370 V241M probably benign Het
Zbtb24 G A 10: 41,462,279 G429D probably damaging Het
Zdhhc2 T C 8: 40,447,098 S68P probably damaging Het
Zfp719 G A 7: 43,584,254 M32I possibly damaging Het
Zfp975 T C 7: 42,662,526 N221S probably benign Het
Other mutations in St5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:St5 APN 7 109527708 missense possibly damaging 0.71
IGL01132:St5 APN 7 109570005 unclassified probably null
IGL01288:St5 APN 7 109539822 missense probably damaging 0.96
IGL01645:St5 APN 7 109527634 nonsense probably null
IGL01714:St5 APN 7 109570062 missense probably damaging 0.99
IGL02021:St5 APN 7 109557372 missense probably damaging 1.00
IGL02302:St5 APN 7 109525331 missense probably damaging 1.00
IGL02496:St5 APN 7 109556235 missense possibly damaging 0.83
IGL02795:St5 APN 7 109556364 missense probably damaging 1.00
FR4340:St5 UTSW 7 109556921 unclassified probably benign
FR4737:St5 UTSW 7 109556921 unclassified probably benign
PIT4466001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4469001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4472001:St5 UTSW 7 109531130 missense probably damaging 1.00
R0024:St5 UTSW 7 109524659 missense probably damaging 1.00
R0124:St5 UTSW 7 109542511 missense possibly damaging 0.66
R0125:St5 UTSW 7 109556338 missense probably benign 0.19
R0365:St5 UTSW 7 109538949 missense probably damaging 1.00
R0491:St5 UTSW 7 109557204 missense probably benign 0.45
R0534:St5 UTSW 7 109541428 missense probably damaging 1.00
R0743:St5 UTSW 7 109557345 missense probably damaging 1.00
R0772:St5 UTSW 7 109542320 splice site probably null
R0774:St5 UTSW 7 109542320 splice site probably null
R0787:St5 UTSW 7 109525620 missense possibly damaging 0.94
R0884:St5 UTSW 7 109557345 missense probably damaging 1.00
R1518:St5 UTSW 7 109557355 missense probably damaging 1.00
R1908:St5 UTSW 7 109525326 nonsense probably null
R1909:St5 UTSW 7 109525326 nonsense probably null
R2232:St5 UTSW 7 109557207 missense probably benign
R2358:St5 UTSW 7 109556446 missense probably benign 0.01
R2847:St5 UTSW 7 109525337 missense probably damaging 1.00
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2873:St5 UTSW 7 109557430 missense probably benign 0.01
R2874:St5 UTSW 7 109557430 missense probably benign 0.01
R4534:St5 UTSW 7 109531156 missense probably damaging 1.00
R4536:St5 UTSW 7 109531156 missense probably damaging 1.00
R4559:St5 UTSW 7 109525578 missense probably damaging 1.00
R4798:St5 UTSW 7 109557033 missense probably damaging 0.99
R4846:St5 UTSW 7 109556836 nonsense probably null
R5110:St5 UTSW 7 109542490 missense probably benign 0.02
R5181:St5 UTSW 7 109556790 missense probably benign
R5268:St5 UTSW 7 109557312 missense probably benign
R5403:St5 UTSW 7 109556905 missense probably damaging 1.00
R5836:St5 UTSW 7 109541345 missense possibly damaging 0.78
R5932:St5 UTSW 7 109570016 missense probably damaging 1.00
R5937:St5 UTSW 7 109557271 missense possibly damaging 0.86
R6180:St5 UTSW 7 109556888 missense probably benign 0.11
R6741:St5 UTSW 7 109545097 missense possibly damaging 0.95
R6781:St5 UTSW 7 109525304 missense possibly damaging 0.83
R7086:St5 UTSW 7 109525574 missense probably damaging 1.00
R7466:St5 UTSW 7 109525346 missense probably damaging 1.00
R7644:St5 UTSW 7 109556793 nonsense probably null
RF062:St5 UTSW 7 109556946 unclassified probably benign
X0067:St5 UTSW 7 109556240 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGGTTCTGTCCAAATAGCTGAAGC -3'
(R):5'- ACTCAGGTCTCTGAGAATGAGCGAG -3'

Sequencing Primer
(F):5'- AATAGCTGAAGCTGGTAGCCTTG -3'
(R):5'- aatcctcttgccttcatctcc -3'
Posted On2013-07-30