Incidental Mutation 'R8050:Arhgef38'
ID 618976
Institutional Source Beutler Lab
Gene Symbol Arhgef38
Ensembl Gene ENSMUSG00000040969
Gene Name Rho guanine nucleotide exchange factor (GEF) 38
Synonyms D630013G24Rik, 9130221D24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8050 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 133112278-133234949 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 133137562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 416 (R416*)
Ref Sequence ENSEMBL: ENSMUSP00000114238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054105] [ENSMUST00000147041]
AlphaFold Q80VK6
Predicted Effect probably benign
Transcript: ENSMUST00000054105
SMART Domains Protein: ENSMUSP00000054558
Gene: ENSMUSG00000040969

DomainStartEndE-ValueType
SH3 1 60 5.56e-1 SMART
low complexity region 95 106 N/A INTRINSIC
SH3 126 189 8.2e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000147041
AA Change: R416*
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969
AA Change: R416*

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,251,253 V194E possibly damaging Het
Adgrv1 T C 13: 81,413,177 N5406S probably damaging Het
Asb7 T A 7: 66,679,184 Q36L probably benign Het
Bbof1 G A 12: 84,411,217 M85I probably benign Het
Bin1 T G 18: 32,406,145 F44V probably damaging Het
Bnc2 C A 4: 84,292,336 V599L probably benign Het
Bnip3l A G 14: 66,989,202 S181P probably damaging Het
Btnl9 A G 11: 49,175,615 L374P probably benign Het
Cd109 T C 9: 78,664,351 I424T probably benign Het
Cdhr2 G A 13: 54,734,222 V1162M probably damaging Het
Dgkb G A 12: 38,124,217 E181K probably benign Het
Dnase1 A T 16: 4,037,997 D64V probably damaging Het
E130308A19Rik T C 4: 59,719,767 I433T probably damaging Het
Ecsit C T 9: 22,076,296 R149H probably benign Het
Enpep A T 3: 129,305,516 V437E probably damaging Het
Esrp1 A T 4: 11,338,767 V679D probably damaging Het
Fa2h T A 8: 111,348,185 probably null Het
Fabp1 G A 6: 71,199,972 E16K probably damaging Het
Fstl5 T A 3: 76,707,503 S624T probably benign Het
Gemin5 G A 11: 58,128,860 R1128W probably benign Het
Gm8300 G A 12: 87,517,141 R82Q possibly damaging Het
Hist1h2bg T C 13: 23,571,667 S79P probably damaging Het
Hps3 T C 3: 20,003,328 H896R probably benign Het
Hsf1 T A 15: 76,498,281 I284K probably benign Het
Igkv3-2 T A 6: 70,699,004 I99N probably damaging Het
Iqub T A 6: 24,503,785 I163F possibly damaging Het
Jak2 T C 19: 29,298,332 I724T probably damaging Het
Kbtbd3 A T 9: 4,330,408 T261S probably benign Het
Kctd20 G T 17: 28,952,758 probably null Het
Kif28 C T 1: 179,709,449 V490M probably benign Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Klhl18 T C 9: 110,428,761 Y537C probably damaging Het
Mut T A 17: 40,943,893 I331K probably benign Het
Myo5a T A 9: 75,181,946 S1119R probably damaging Het
Napepld C A 5: 21,665,321 E366D probably benign Het
Nbea A G 3: 55,987,981 V1540A probably damaging Het
Neb T A 2: 52,221,726 I130L probably benign Het
Olfr130 T C 17: 38,067,479 S103P probably damaging Het
Olfr18 C T 9: 20,314,645 D92N probably damaging Het
Olfr458 A T 6: 42,460,830 L63H probably damaging Het
Opcml T C 9: 28,813,344 V146A probably damaging Het
Pappa2 A C 1: 158,848,400 C925W probably damaging Het
Parp12 T A 6: 39,089,104 N562Y probably damaging Het
Patj C A 4: 98,538,964 H1198Q probably benign Het
Pcyox1 T A 6: 86,389,146 K362M possibly damaging Het
Pcyt2 T C 11: 120,610,939 Y350C probably benign Het
Pkd1 A T 17: 24,565,643 T388S probably benign Het
Prl3d1 T A 13: 27,100,028 Y193* probably null Het
Psme1 A T 14: 55,579,599 D15V possibly damaging Het
Qrsl1 G A 10: 43,874,635 R476C probably damaging Het
Ranbp2 A G 10: 58,479,619 N2054D probably damaging Het
Serpinb1c T A 13: 32,882,069 K298* probably null Het
Slc22a27 A T 19: 7,880,167 M355K probably benign Het
Spp1 T A 5: 104,440,414 H227Q probably benign Het
Stam2 T A 2: 52,719,773 N75I probably damaging Het
Tacc1 T C 8: 25,169,214 T579A probably benign Het
Tbx3 A G 5: 119,683,067 D734G probably benign Het
Tmem233 G T 5: 116,083,082 S35* probably null Het
Trim43c A T 9: 88,840,337 E12V probably damaging Het
Trio A G 15: 27,891,454 S463P unknown Het
Uggt2 A T 14: 119,026,422 D1065E probably damaging Het
Usp1 A G 4: 98,928,913 N114S probably benign Het
Usp34 A G 11: 23,446,787 E2377G Het
Virma T A 4: 11,528,643 H1243Q probably benign Het
Vmn2r3 A T 3: 64,271,293 V517D probably damaging Het
Zfp931 T C 2: 178,068,096 K166E probably damaging Het
Zp3 T A 5: 135,982,750 Y141N probably damaging Het
Other mutations in Arhgef38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Arhgef38 APN 3 133132051 missense probably benign 0.05
IGL00533:Arhgef38 APN 3 133116459 nonsense probably null
IGL03031:Arhgef38 APN 3 133132067 missense possibly damaging 0.90
F5770:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
PIT4362001:Arhgef38 UTSW 3 133160830 missense
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0076:Arhgef38 UTSW 3 133160746 missense possibly damaging 0.52
R0515:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
R0730:Arhgef38 UTSW 3 133137471 missense probably benign 0.25
R0765:Arhgef38 UTSW 3 133116583 missense probably damaging 1.00
R1054:Arhgef38 UTSW 3 133116465 missense probably damaging 1.00
R1261:Arhgef38 UTSW 3 133160863 missense possibly damaging 0.52
R1568:Arhgef38 UTSW 3 133132464 missense probably damaging 0.98
R1580:Arhgef38 UTSW 3 133133704 missense probably benign 0.24
R1716:Arhgef38 UTSW 3 133140837 missense probably benign 0.35
R1875:Arhgef38 UTSW 3 133133740 critical splice acceptor site probably null
R2118:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2119:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2122:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2417:Arhgef38 UTSW 3 133146473 missense probably damaging 1.00
R3832:Arhgef38 UTSW 3 133206925 missense possibly damaging 0.89
R4657:Arhgef38 UTSW 3 133234681 missense probably damaging 1.00
R4666:Arhgef38 UTSW 3 133140772 critical splice donor site probably null
R4732:Arhgef38 UTSW 3 133132269 nonsense probably null
R4733:Arhgef38 UTSW 3 133132269 nonsense probably null
R5059:Arhgef38 UTSW 3 133137414 missense probably damaging 1.00
R5108:Arhgef38 UTSW 3 133137268 missense probably benign 0.14
R5310:Arhgef38 UTSW 3 133116466 missense probably damaging 0.98
R5820:Arhgef38 UTSW 3 133160799 missense probably benign 0.44
R5987:Arhgef38 UTSW 3 133206958 missense possibly damaging 0.67
R6115:Arhgef38 UTSW 3 133132613 splice site probably null
R6313:Arhgef38 UTSW 3 133234708 missense possibly damaging 0.80
R6339:Arhgef38 UTSW 3 133133662 missense probably benign 0.35
R6356:Arhgef38 UTSW 3 133140877 missense probably benign 0.01
R6648:Arhgef38 UTSW 3 133132475 missense probably damaging 1.00
R7050:Arhgef38 UTSW 3 133133627 start gained probably benign
R7083:Arhgef38 UTSW 3 133132436 missense unknown
R7561:Arhgef38 UTSW 3 133160728 missense
R7769:Arhgef38 UTSW 3 133149622 missense unknown
R8471:Arhgef38 UTSW 3 133234711 missense probably damaging 1.00
R8835:Arhgef38 UTSW 3 133132071 missense unknown
R9151:Arhgef38 UTSW 3 133206945 missense
R9154:Arhgef38 UTSW 3 133132163 missense unknown
R9263:Arhgef38 UTSW 3 133160768 missense
R9367:Arhgef38 UTSW 3 133142237 missense unknown
Z1177:Arhgef38 UTSW 3 133206961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCTCTTCCACAAGTTG -3'
(R):5'- TTCAGGCTCTGTATTACCGC -3'

Sequencing Primer
(F):5'- CTCTTCCACAAGTTGGGCATTGAG -3'
(R):5'- GGCTCTGTATTACCGCTTTAATAAAC -3'
Posted On 2020-01-23