Incidental Mutation 'R8050:Fabp1'
ID618992
Institutional Source Beutler Lab
Gene Symbol Fabp1
Ensembl Gene ENSMUSG00000054422
Gene Namefatty acid binding protein 1, liver
SynonymsL-FABP, Fabpl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R8050 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location71199827-71205023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71199972 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 16 (E16K)
Ref Sequence ENSEMBL: ENSMUSP00000064655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067492]
Predicted Effect probably damaging
Transcript: ENSMUST00000067492
AA Change: E16K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064655
Gene: ENSMUSG00000054422
AA Change: E16K

DomainStartEndE-ValueType
Pfam:Lipocalin_7 1 127 1.2e-32 PFAM
Pfam:Lipocalin 4 127 8.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the fatty acid binding protein found in liver. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. This protein and FABP6 (the ileal fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene do not show any obvious morphological, behavioral, or reproductive abnormalities. Changes may be observed in lipid composition, lipid binding, or levels of lipid binding proteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,251,253 V194E possibly damaging Het
Adgrv1 T C 13: 81,413,177 N5406S probably damaging Het
Arhgef38 T A 3: 133,137,562 R416* probably null Het
Asb7 T A 7: 66,679,184 Q36L probably benign Het
Bbof1 G A 12: 84,411,217 M85I probably benign Het
Bin1 T G 18: 32,406,145 F44V probably damaging Het
Bnc2 C A 4: 84,292,336 V599L probably benign Het
Bnip3l A G 14: 66,989,202 S181P probably damaging Het
Btnl9 A G 11: 49,175,615 L374P probably benign Het
Cd109 T C 9: 78,664,351 I424T probably benign Het
Cdhr2 G A 13: 54,734,222 V1162M probably damaging Het
Dgkb G A 12: 38,124,217 E181K probably benign Het
Dnase1 A T 16: 4,037,997 D64V probably damaging Het
E130308A19Rik T C 4: 59,719,767 I433T probably damaging Het
Ecsit C T 9: 22,076,296 R149H probably benign Het
Enpep A T 3: 129,305,516 V437E probably damaging Het
Esrp1 A T 4: 11,338,767 V679D probably damaging Het
Fa2h T A 8: 111,348,185 probably null Het
Fstl5 T A 3: 76,707,503 S624T probably benign Het
Gemin5 G A 11: 58,128,860 R1128W probably benign Het
Gm8300 G A 12: 87,517,141 R82Q possibly damaging Het
Hist1h2bg T C 13: 23,571,667 S79P probably damaging Het
Hps3 T C 3: 20,003,328 H896R probably benign Het
Hsf1 T A 15: 76,498,281 I284K probably benign Het
Igkv3-2 T A 6: 70,699,004 I99N probably damaging Het
Iqub T A 6: 24,503,785 I163F possibly damaging Het
Jak2 T C 19: 29,298,332 I724T probably damaging Het
Kbtbd3 A T 9: 4,330,408 T261S probably benign Het
Kctd20 G T 17: 28,952,758 probably null Het
Kif28 C T 1: 179,709,449 V490M probably benign Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Klhl18 T C 9: 110,428,761 Y537C probably damaging Het
Mut T A 17: 40,943,893 I331K probably benign Het
Myo5a T A 9: 75,181,946 S1119R probably damaging Het
Napepld C A 5: 21,665,321 E366D probably benign Het
Nbea A G 3: 55,987,981 V1540A probably damaging Het
Neb T A 2: 52,221,726 I130L probably benign Het
Olfr130 T C 17: 38,067,479 S103P probably damaging Het
Olfr18 C T 9: 20,314,645 D92N probably damaging Het
Olfr458 A T 6: 42,460,830 L63H probably damaging Het
Opcml T C 9: 28,813,344 V146A probably damaging Het
Pappa2 A C 1: 158,848,400 C925W probably damaging Het
Parp12 T A 6: 39,089,104 N562Y probably damaging Het
Patj C A 4: 98,538,964 H1198Q probably benign Het
Pcyox1 T A 6: 86,389,146 K362M possibly damaging Het
Pcyt2 T C 11: 120,610,939 Y350C probably benign Het
Pkd1 A T 17: 24,565,643 T388S probably benign Het
Prl3d1 T A 13: 27,100,028 Y193* probably null Het
Psme1 A T 14: 55,579,599 D15V possibly damaging Het
Qrsl1 G A 10: 43,874,635 R476C probably damaging Het
Ranbp2 A G 10: 58,479,619 N2054D probably damaging Het
Serpinb1c T A 13: 32,882,069 K298* probably null Het
Slc22a27 A T 19: 7,880,167 M355K probably benign Het
Spp1 T A 5: 104,440,414 H227Q probably benign Het
Stam2 T A 2: 52,719,773 N75I probably damaging Het
Tacc1 T C 8: 25,169,214 T579A probably benign Het
Tbx3 A G 5: 119,683,067 D734G probably benign Het
Tmem233 G T 5: 116,083,082 S35* probably null Het
Trim43c A T 9: 88,840,337 E12V probably damaging Het
Trio A G 15: 27,891,454 S463P unknown Het
Uggt2 A T 14: 119,026,422 D1065E probably damaging Het
Usp1 A G 4: 98,928,913 N114S probably benign Het
Usp34 A G 11: 23,446,787 E2377G Het
Virma T A 4: 11,528,643 H1243Q probably benign Het
Vmn2r3 A T 3: 64,271,293 V517D probably damaging Het
Zfp931 T C 2: 178,068,096 K166E probably damaging Het
Zp3 T A 5: 135,982,750 Y141N probably damaging Het
Other mutations in Fabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Fabp1 APN 6 71203144 missense probably damaging 1.00
R0422:Fabp1 UTSW 6 71203093 missense possibly damaging 0.92
R3437:Fabp1 UTSW 6 71201611 missense probably benign 0.44
R5218:Fabp1 UTSW 6 71199960 missense probably damaging 0.99
R7023:Fabp1 UTSW 6 71203085 critical splice acceptor site probably null
R7289:Fabp1 UTSW 6 71203127 missense probably benign 0.00
X0063:Fabp1 UTSW 6 71201622 missense possibly damaging 0.91
Z1176:Fabp1 UTSW 6 71199955 missense possibly damaging 0.74
Z1177:Fabp1 UTSW 6 71201736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAATGTTTGAGCCTGGCC -3'
(R):5'- GTTTCCACTTCCCTGGAGTAGC -3'

Sequencing Primer
(F):5'- TGAGCCTGGCCATAAATAAATCG -3'
(R):5'- CCCTGGAGTAGCTTTGTCC -3'
Posted On2020-01-23