Incidental Mutation 'R8050:Olfr18'
ID618999
Institutional Source Beutler Lab
Gene Symbol Olfr18
Ensembl Gene ENSMUSG00000066896
Gene Nameolfactory receptor 18
SynonymsGA_x6K02T2PVTD-14054886-14053957, MOR145-1, MTPCR34
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8050 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location20312152-20336094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20314645 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 92 (D92N)
Ref Sequence ENSEMBL: ENSMUSP00000083664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086473] [ENSMUST00000212943]
Predicted Effect probably damaging
Transcript: ENSMUST00000086473
AA Change: D92N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083664
Gene: ENSMUSG00000066896
AA Change: D92N

DomainStartEndE-ValueType
Pfam:7tm_4 53 330 1.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 57 234 3.2e-9 PFAM
Pfam:7tm_1 63 312 4.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212943
AA Change: D84N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,251,253 V194E possibly damaging Het
Adgrv1 T C 13: 81,413,177 N5406S probably damaging Het
Arhgef38 T A 3: 133,137,562 R416* probably null Het
Asb7 T A 7: 66,679,184 Q36L probably benign Het
Bbof1 G A 12: 84,411,217 M85I probably benign Het
Bin1 T G 18: 32,406,145 F44V probably damaging Het
Bnc2 C A 4: 84,292,336 V599L probably benign Het
Bnip3l A G 14: 66,989,202 S181P probably damaging Het
Btnl9 A G 11: 49,175,615 L374P probably benign Het
Cd109 T C 9: 78,664,351 I424T probably benign Het
Cdhr2 G A 13: 54,734,222 V1162M probably damaging Het
Dgkb G A 12: 38,124,217 E181K probably benign Het
Dnase1 A T 16: 4,037,997 D64V probably damaging Het
E130308A19Rik T C 4: 59,719,767 I433T probably damaging Het
Ecsit C T 9: 22,076,296 R149H probably benign Het
Enpep A T 3: 129,305,516 V437E probably damaging Het
Esrp1 A T 4: 11,338,767 V679D probably damaging Het
Fa2h T A 8: 111,348,185 probably null Het
Fabp1 G A 6: 71,199,972 E16K probably damaging Het
Fstl5 T A 3: 76,707,503 S624T probably benign Het
Gemin5 G A 11: 58,128,860 R1128W probably benign Het
Gm8300 G A 12: 87,517,141 R82Q possibly damaging Het
Hist1h2bg T C 13: 23,571,667 S79P probably damaging Het
Hps3 T C 3: 20,003,328 H896R probably benign Het
Hsf1 T A 15: 76,498,281 I284K probably benign Het
Igkv3-2 T A 6: 70,699,004 I99N probably damaging Het
Iqub T A 6: 24,503,785 I163F possibly damaging Het
Jak2 T C 19: 29,298,332 I724T probably damaging Het
Kbtbd3 A T 9: 4,330,408 T261S probably benign Het
Kctd20 G T 17: 28,952,758 probably null Het
Kif28 C T 1: 179,709,449 V490M probably benign Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Klhl18 T C 9: 110,428,761 Y537C probably damaging Het
Mut T A 17: 40,943,893 I331K probably benign Het
Myo5a T A 9: 75,181,946 S1119R probably damaging Het
Napepld C A 5: 21,665,321 E366D probably benign Het
Nbea A G 3: 55,987,981 V1540A probably damaging Het
Neb T A 2: 52,221,726 I130L probably benign Het
Olfr130 T C 17: 38,067,479 S103P probably damaging Het
Olfr458 A T 6: 42,460,830 L63H probably damaging Het
Opcml T C 9: 28,813,344 V146A probably damaging Het
Pappa2 A C 1: 158,848,400 C925W probably damaging Het
Parp12 T A 6: 39,089,104 N562Y probably damaging Het
Patj C A 4: 98,538,964 H1198Q probably benign Het
Pcyox1 T A 6: 86,389,146 K362M possibly damaging Het
Pcyt2 T C 11: 120,610,939 Y350C probably benign Het
Pkd1 A T 17: 24,565,643 T388S probably benign Het
Prl3d1 T A 13: 27,100,028 Y193* probably null Het
Psme1 A T 14: 55,579,599 D15V possibly damaging Het
Qrsl1 G A 10: 43,874,635 R476C probably damaging Het
Ranbp2 A G 10: 58,479,619 N2054D probably damaging Het
Serpinb1c T A 13: 32,882,069 K298* probably null Het
Slc22a27 A T 19: 7,880,167 M355K probably benign Het
Spp1 T A 5: 104,440,414 H227Q probably benign Het
Stam2 T A 2: 52,719,773 N75I probably damaging Het
Tacc1 T C 8: 25,169,214 T579A probably benign Het
Tbx3 A G 5: 119,683,067 D734G probably benign Het
Tmem233 G T 5: 116,083,082 S35* probably null Het
Trim43c A T 9: 88,840,337 E12V probably damaging Het
Trio A G 15: 27,891,454 S463P unknown Het
Uggt2 A T 14: 119,026,422 D1065E probably damaging Het
Usp1 A G 4: 98,928,913 N114S probably benign Het
Usp34 A G 11: 23,446,787 E2377G Het
Virma T A 4: 11,528,643 H1243Q probably benign Het
Vmn2r3 A T 3: 64,271,293 V517D probably damaging Het
Zfp931 T C 2: 178,068,096 K166E probably damaging Het
Zp3 T A 5: 135,982,750 Y141N probably damaging Het
Other mutations in Olfr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Olfr18 APN 9 20314719 missense probably damaging 1.00
IGL02412:Olfr18 APN 9 20314639 missense probably benign
IGL03288:Olfr18 APN 9 20335911 critical splice donor site probably null
IGL03395:Olfr18 APN 9 20314551 missense probably damaging 1.00
R0332:Olfr18 UTSW 9 20314056 missense probably benign 0.00
R0346:Olfr18 UTSW 9 20314411 missense probably benign 0.20
R0569:Olfr18 UTSW 9 20314579 missense probably damaging 1.00
R0798:Olfr18 UTSW 9 20314199 nonsense probably null
R0865:Olfr18 UTSW 9 20314749 missense probably damaging 1.00
R1082:Olfr18 UTSW 9 20314469 missense possibly damaging 0.52
R1905:Olfr18 UTSW 9 20314846 missense probably benign
R4245:Olfr18 UTSW 9 20314333 missense possibly damaging 0.87
R5566:Olfr18 UTSW 9 20313969 missense probably benign
R6306:Olfr18 UTSW 9 20314446 missense probably benign 0.25
R6721:Olfr18 UTSW 9 20314280 missense probably benign 0.24
R6787:Olfr18 UTSW 9 20335925 missense probably benign
R6930:Olfr18 UTSW 9 20314099 missense probably damaging 1.00
R7196:Olfr18 UTSW 9 20314198 missense probably benign 0.38
R7711:Olfr18 UTSW 9 20314023 missense possibly damaging 0.66
R8023:Olfr18 UTSW 9 20314249 missense probably benign 0.00
R8029:Olfr18 UTSW 9 20314347 missense possibly damaging 0.59
R8058:Olfr18 UTSW 9 20314180 missense probably damaging 0.99
R8159:Olfr18 UTSW 9 20314719 missense possibly damaging 0.96
R8201:Olfr18 UTSW 9 20314612 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCCACAAAGACGAGGGTTC -3'
(R):5'- CCGTATCTCAGAATTCCACCTCATG -3'

Sequencing Primer
(F):5'- TTCATAATGAACTGGTAGTGCAAAGG -3'
(R):5'- TCATGGGACTCTCAGATGACCTG -3'
Posted On2020-01-23