Incidental Mutation 'R8050:Kif9'
ID619006
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Namekinesin family member 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R8050 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110476958-110525179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110519140 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 677 (L677P)
Ref Sequence ENSEMBL: ENSMUSP00000142734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043]
Predicted Effect probably damaging
Transcript: ENSMUST00000061155
AA Change: L677P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: L677P

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084952
AA Change: L677P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: L677P

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197248
AA Change: L677P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: L677P

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198043
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,251,253 V194E possibly damaging Het
Adgrv1 T C 13: 81,413,177 N5406S probably damaging Het
Arhgef38 T A 3: 133,137,562 R416* probably null Het
Asb7 T A 7: 66,679,184 Q36L probably benign Het
Bbof1 G A 12: 84,411,217 M85I probably benign Het
Bin1 T G 18: 32,406,145 F44V probably damaging Het
Bnc2 C A 4: 84,292,336 V599L probably benign Het
Bnip3l A G 14: 66,989,202 S181P probably damaging Het
Btnl9 A G 11: 49,175,615 L374P probably benign Het
Cd109 T C 9: 78,664,351 I424T probably benign Het
Cdhr2 G A 13: 54,734,222 V1162M probably damaging Het
Dgkb G A 12: 38,124,217 E181K probably benign Het
Dnase1 A T 16: 4,037,997 D64V probably damaging Het
E130308A19Rik T C 4: 59,719,767 I433T probably damaging Het
Ecsit C T 9: 22,076,296 R149H probably benign Het
Enpep A T 3: 129,305,516 V437E probably damaging Het
Esrp1 A T 4: 11,338,767 V679D probably damaging Het
Fa2h T A 8: 111,348,185 probably null Het
Fabp1 G A 6: 71,199,972 E16K probably damaging Het
Fstl5 T A 3: 76,707,503 S624T probably benign Het
Gemin5 G A 11: 58,128,860 R1128W probably benign Het
Gm8300 G A 12: 87,517,141 R82Q possibly damaging Het
Hist1h2bg T C 13: 23,571,667 S79P probably damaging Het
Hps3 T C 3: 20,003,328 H896R probably benign Het
Hsf1 T A 15: 76,498,281 I284K probably benign Het
Igkv3-2 T A 6: 70,699,004 I99N probably damaging Het
Iqub T A 6: 24,503,785 I163F possibly damaging Het
Jak2 T C 19: 29,298,332 I724T probably damaging Het
Kbtbd3 A T 9: 4,330,408 T261S probably benign Het
Kctd20 G T 17: 28,952,758 probably null Het
Kif28 C T 1: 179,709,449 V490M probably benign Het
Klhl18 T C 9: 110,428,761 Y537C probably damaging Het
Mut T A 17: 40,943,893 I331K probably benign Het
Myo5a T A 9: 75,181,946 S1119R probably damaging Het
Napepld C A 5: 21,665,321 E366D probably benign Het
Nbea A G 3: 55,987,981 V1540A probably damaging Het
Neb T A 2: 52,221,726 I130L probably benign Het
Olfr130 T C 17: 38,067,479 S103P probably damaging Het
Olfr18 C T 9: 20,314,645 D92N probably damaging Het
Olfr458 A T 6: 42,460,830 L63H probably damaging Het
Opcml T C 9: 28,813,344 V146A probably damaging Het
Pappa2 A C 1: 158,848,400 C925W probably damaging Het
Parp12 T A 6: 39,089,104 N562Y probably damaging Het
Patj C A 4: 98,538,964 H1198Q probably benign Het
Pcyox1 T A 6: 86,389,146 K362M possibly damaging Het
Pcyt2 T C 11: 120,610,939 Y350C probably benign Het
Pkd1 A T 17: 24,565,643 T388S probably benign Het
Prl3d1 T A 13: 27,100,028 Y193* probably null Het
Psme1 A T 14: 55,579,599 D15V possibly damaging Het
Qrsl1 G A 10: 43,874,635 R476C probably damaging Het
Ranbp2 A G 10: 58,479,619 N2054D probably damaging Het
Serpinb1c T A 13: 32,882,069 K298* probably null Het
Slc22a27 A T 19: 7,880,167 M355K probably benign Het
Spp1 T A 5: 104,440,414 H227Q probably benign Het
Stam2 T A 2: 52,719,773 N75I probably damaging Het
Tacc1 T C 8: 25,169,214 T579A probably benign Het
Tbx3 A G 5: 119,683,067 D734G probably benign Het
Tmem233 G T 5: 116,083,082 S35* probably null Het
Trim43c A T 9: 88,840,337 E12V probably damaging Het
Trio A G 15: 27,891,454 S463P unknown Het
Uggt2 A T 14: 119,026,422 D1065E probably damaging Het
Usp1 A G 4: 98,928,913 N114S probably benign Het
Usp34 A G 11: 23,446,787 E2377G Het
Virma T A 4: 11,528,643 H1243Q probably benign Het
Vmn2r3 A T 3: 64,271,293 V517D probably damaging Het
Zfp931 T C 2: 178,068,096 K166E probably damaging Het
Zp3 T A 5: 135,982,750 Y141N probably damaging Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110485070 missense probably benign 0.03
IGL02273:Kif9 APN 9 110510470 missense probably damaging 0.99
IGL02818:Kif9 APN 9 110485149 missense probably damaging 1.00
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0137:Kif9 UTSW 9 110485038 missense probably damaging 1.00
R0594:Kif9 UTSW 9 110511340 missense probably benign 0.22
R1503:Kif9 UTSW 9 110510438 missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110489966 missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110517633 missense probably benign 0.34
R1856:Kif9 UTSW 9 110517719 missense probably null 1.00
R2076:Kif9 UTSW 9 110485032 splice site probably null
R3407:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R4247:Kif9 UTSW 9 110495959 critical splice donor site probably null
R4487:Kif9 UTSW 9 110494484 missense probably null 1.00
R4515:Kif9 UTSW 9 110489867 missense probably benign 0.38
R4880:Kif9 UTSW 9 110501635 missense probably damaging 0.98
R5024:Kif9 UTSW 9 110483093 missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110489897 missense probably damaging 1.00
R5181:Kif9 UTSW 9 110521268 missense probably damaging 1.00
R5362:Kif9 UTSW 9 110489944 missense probably damaging 0.99
R5379:Kif9 UTSW 9 110521303 missense probably benign 0.00
R5628:Kif9 UTSW 9 110514553 nonsense probably null
R5653:Kif9 UTSW 9 110524931 missense probably damaging 1.00
R5698:Kif9 UTSW 9 110510464 missense probably benign
R5758:Kif9 UTSW 9 110489879 missense probably damaging 1.00
R5986:Kif9 UTSW 9 110490026 missense probably benign 0.05
R6103:Kif9 UTSW 9 110489849 missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110488544 missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110517834 splice site probably null
R6991:Kif9 UTSW 9 110494622 missense probably damaging 1.00
R7113:Kif9 UTSW 9 110506664 missense probably damaging 1.00
R7459:Kif9 UTSW 9 110519041 missense probably damaging 1.00
R7593:Kif9 UTSW 9 110521353 missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110514614 missense not run
R8370:Kif9 UTSW 9 110488613 missense probably damaging 1.00
R8549:Kif9 UTSW 9 110514419 splice site probably null
R8751:Kif9 UTSW 9 110501656 missense probably benign 0.03
R8830:Kif9 UTSW 9 110524930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGATCGTCATCATTTTG -3'
(R):5'- AGCACATACCTGAAGCCTCTG -3'

Sequencing Primer
(F):5'- GGATCGTCATCATTTTGGAACACCG -3'
(R):5'- TGAAGCCTCTGACCAATCCCTG -3'
Posted On2020-01-23