Incidental Mutation 'R8050:Kif9'
ID 619006
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Name kinesin family member 9
Synonyms
MMRRC Submission 067487-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8050 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 110306062-110354242 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110348208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 677 (L677P)
Ref Sequence ENSEMBL: ENSMUSP00000142734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043]
AlphaFold Q9WV04
Predicted Effect probably damaging
Transcript: ENSMUST00000061155
AA Change: L677P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: L677P

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084952
AA Change: L677P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: L677P

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197248
AA Change: L677P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: L677P

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198043
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 43,900,677 (GRCm39) V194E possibly damaging Het
Adgrv1 T C 13: 81,561,296 (GRCm39) N5406S probably damaging Het
Arhgef38 T A 3: 132,843,323 (GRCm39) R416* probably null Het
Asb7 T A 7: 66,328,932 (GRCm39) Q36L probably benign Het
Bbof1 G A 12: 84,457,991 (GRCm39) M85I probably benign Het
Bin1 T G 18: 32,539,198 (GRCm39) F44V probably damaging Het
Bnc2 C A 4: 84,210,573 (GRCm39) V599L probably benign Het
Bnip3l A G 14: 67,226,651 (GRCm39) S181P probably damaging Het
Btnl9 A G 11: 49,066,442 (GRCm39) L374P probably benign Het
Cd109 T C 9: 78,571,633 (GRCm39) I424T probably benign Het
Cdhr2 G A 13: 54,882,035 (GRCm39) V1162M probably damaging Het
Dgkb G A 12: 38,174,216 (GRCm39) E181K probably benign Het
Dnase1 A T 16: 3,855,861 (GRCm39) D64V probably damaging Het
E130308A19Rik T C 4: 59,719,767 (GRCm39) I433T probably damaging Het
Ecsit C T 9: 21,987,592 (GRCm39) R149H probably benign Het
Eif1ad8 G A 12: 87,563,911 (GRCm39) R82Q possibly damaging Het
Enpep A T 3: 129,099,165 (GRCm39) V437E probably damaging Het
Esrp1 A T 4: 11,338,767 (GRCm39) V679D probably damaging Het
Fa2h T A 8: 112,074,817 (GRCm39) probably null Het
Fabp1 G A 6: 71,176,956 (GRCm39) E16K probably damaging Het
Fstl5 T A 3: 76,614,810 (GRCm39) S624T probably benign Het
Gemin5 G A 11: 58,019,686 (GRCm39) R1128W probably benign Het
H2bc8 T C 13: 23,755,841 (GRCm39) S79P probably damaging Het
Hps3 T C 3: 20,057,492 (GRCm39) H896R probably benign Het
Hsf1 T A 15: 76,382,481 (GRCm39) I284K probably benign Het
Igkv3-2 T A 6: 70,675,988 (GRCm39) I99N probably damaging Het
Iqub T A 6: 24,503,784 (GRCm39) I163F possibly damaging Het
Jak2 T C 19: 29,275,732 (GRCm39) I724T probably damaging Het
Kbtbd3 A T 9: 4,330,408 (GRCm39) T261S probably benign Het
Kctd20 G T 17: 29,171,732 (GRCm39) probably null Het
Kif28 C T 1: 179,537,014 (GRCm39) V490M probably benign Het
Klhl18 T C 9: 110,257,829 (GRCm39) Y537C probably damaging Het
Mmut T A 17: 41,254,784 (GRCm39) I331K probably benign Het
Myo5a T A 9: 75,089,228 (GRCm39) S1119R probably damaging Het
Napepld C A 5: 21,870,319 (GRCm39) E366D probably benign Het
Nbea A G 3: 55,895,402 (GRCm39) V1540A probably damaging Het
Neb T A 2: 52,111,738 (GRCm39) I130L probably benign Het
Opcml T C 9: 28,724,640 (GRCm39) V146A probably damaging Het
Or2g7 T C 17: 38,378,370 (GRCm39) S103P probably damaging Het
Or2r11 A T 6: 42,437,764 (GRCm39) L63H probably damaging Het
Or7e178 C T 9: 20,225,941 (GRCm39) D92N probably damaging Het
Pappa2 A C 1: 158,675,970 (GRCm39) C925W probably damaging Het
Parp12 T A 6: 39,066,038 (GRCm39) N562Y probably damaging Het
Patj C A 4: 98,427,201 (GRCm39) H1198Q probably benign Het
Pcyox1 T A 6: 86,366,128 (GRCm39) K362M possibly damaging Het
Pcyt2 T C 11: 120,501,765 (GRCm39) Y350C probably benign Het
Pkd1 A T 17: 24,784,617 (GRCm39) T388S probably benign Het
Prl3d1 T A 13: 27,284,011 (GRCm39) Y193* probably null Het
Psme1 A T 14: 55,817,056 (GRCm39) D15V possibly damaging Het
Qrsl1 G A 10: 43,750,631 (GRCm39) R476C probably damaging Het
Ranbp2 A G 10: 58,315,441 (GRCm39) N2054D probably damaging Het
Serpinb1c T A 13: 33,066,052 (GRCm39) K298* probably null Het
Slc22a27 A T 19: 7,857,532 (GRCm39) M355K probably benign Het
Spp1 T A 5: 104,588,280 (GRCm39) H227Q probably benign Het
Stam2 T A 2: 52,609,785 (GRCm39) N75I probably damaging Het
Tacc1 T C 8: 25,659,230 (GRCm39) T579A probably benign Het
Tbx3 A G 5: 119,821,132 (GRCm39) D734G probably benign Het
Tmem233 G T 5: 116,221,141 (GRCm39) S35* probably null Het
Trim43c A T 9: 88,722,390 (GRCm39) E12V probably damaging Het
Trio A G 15: 27,891,540 (GRCm39) S463P unknown Het
Uggt2 A T 14: 119,263,834 (GRCm39) D1065E probably damaging Het
Usp1 A G 4: 98,817,150 (GRCm39) N114S probably benign Het
Usp34 A G 11: 23,396,787 (GRCm39) E2377G Het
Virma T A 4: 11,528,643 (GRCm39) H1243Q probably benign Het
Vmn2r3 A T 3: 64,178,714 (GRCm39) V517D probably damaging Het
Zfp931 T C 2: 177,709,889 (GRCm39) K166E probably damaging Het
Zp3 T A 5: 136,011,604 (GRCm39) Y141N probably damaging Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110,314,138 (GRCm39) missense probably benign 0.03
IGL02273:Kif9 APN 9 110,339,538 (GRCm39) missense probably damaging 0.99
IGL02818:Kif9 APN 9 110,314,217 (GRCm39) missense probably damaging 1.00
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0137:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably damaging 1.00
R0594:Kif9 UTSW 9 110,340,408 (GRCm39) missense probably benign 0.22
R1503:Kif9 UTSW 9 110,339,506 (GRCm39) missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110,319,034 (GRCm39) missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110,346,701 (GRCm39) missense probably benign 0.34
R1856:Kif9 UTSW 9 110,346,787 (GRCm39) missense probably null 1.00
R2076:Kif9 UTSW 9 110,314,100 (GRCm39) splice site probably null
R3407:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R4247:Kif9 UTSW 9 110,325,027 (GRCm39) critical splice donor site probably null
R4487:Kif9 UTSW 9 110,323,552 (GRCm39) missense probably null 1.00
R4515:Kif9 UTSW 9 110,318,935 (GRCm39) missense probably benign 0.38
R4880:Kif9 UTSW 9 110,330,703 (GRCm39) missense probably damaging 0.98
R5024:Kif9 UTSW 9 110,312,161 (GRCm39) missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110,318,965 (GRCm39) missense probably damaging 1.00
R5181:Kif9 UTSW 9 110,350,336 (GRCm39) missense probably damaging 1.00
R5362:Kif9 UTSW 9 110,319,012 (GRCm39) missense probably damaging 0.99
R5379:Kif9 UTSW 9 110,350,371 (GRCm39) missense probably benign 0.00
R5628:Kif9 UTSW 9 110,343,621 (GRCm39) nonsense probably null
R5653:Kif9 UTSW 9 110,353,999 (GRCm39) missense probably damaging 1.00
R5698:Kif9 UTSW 9 110,339,532 (GRCm39) missense probably benign
R5758:Kif9 UTSW 9 110,318,947 (GRCm39) missense probably damaging 1.00
R5986:Kif9 UTSW 9 110,319,094 (GRCm39) missense probably benign 0.05
R6103:Kif9 UTSW 9 110,318,917 (GRCm39) missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110,317,612 (GRCm39) missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110,346,902 (GRCm39) splice site probably null
R6991:Kif9 UTSW 9 110,323,690 (GRCm39) missense probably damaging 1.00
R7113:Kif9 UTSW 9 110,335,732 (GRCm39) missense probably damaging 1.00
R7459:Kif9 UTSW 9 110,348,109 (GRCm39) missense probably damaging 1.00
R7593:Kif9 UTSW 9 110,350,421 (GRCm39) missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110,343,682 (GRCm39) missense not run
R8370:Kif9 UTSW 9 110,317,681 (GRCm39) missense probably damaging 1.00
R8549:Kif9 UTSW 9 110,343,487 (GRCm39) splice site probably null
R8751:Kif9 UTSW 9 110,330,724 (GRCm39) missense probably benign 0.03
R8830:Kif9 UTSW 9 110,353,998 (GRCm39) missense probably damaging 1.00
R9489:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9519:Kif9 UTSW 9 110,350,344 (GRCm39) missense probably damaging 0.98
R9605:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9776:Kif9 UTSW 9 110,350,398 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCAGGATCGTCATCATTTTG -3'
(R):5'- AGCACATACCTGAAGCCTCTG -3'

Sequencing Primer
(F):5'- GGATCGTCATCATTTTGGAACACCG -3'
(R):5'- TGAAGCCTCTGACCAATCCCTG -3'
Posted On 2020-01-23