Incidental Mutation 'R8050:Olfr130'
ID 619029
Institutional Source Beutler Lab
Gene Symbol Olfr130
Ensembl Gene ENSMUSG00000094878
Gene Name olfactory receptor 130
Synonyms GA_x6K02T2PSCP-2515350-2516303, MOR256-19
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R8050 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 38063921-38072790 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38067479 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 103 (S103P)
Ref Sequence ENSEMBL: ENSMUSP00000149963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087129] [ENSMUST00000215726] [ENSMUST00000217390]
AlphaFold Q8VFC1
Predicted Effect probably damaging
Transcript: ENSMUST00000087129
AA Change: S103P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084369
Gene: ENSMUSG00000094878
AA Change: S103P

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 223 1.9e-5 PFAM
Pfam:7tm_1 40 289 1.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215726
AA Change: S103P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217390
AA Change: S103P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,251,253 V194E possibly damaging Het
Adgrv1 T C 13: 81,413,177 N5406S probably damaging Het
Arhgef38 T A 3: 133,137,562 R416* probably null Het
Asb7 T A 7: 66,679,184 Q36L probably benign Het
Bbof1 G A 12: 84,411,217 M85I probably benign Het
Bin1 T G 18: 32,406,145 F44V probably damaging Het
Bnc2 C A 4: 84,292,336 V599L probably benign Het
Bnip3l A G 14: 66,989,202 S181P probably damaging Het
Btnl9 A G 11: 49,175,615 L374P probably benign Het
Cd109 T C 9: 78,664,351 I424T probably benign Het
Cdhr2 G A 13: 54,734,222 V1162M probably damaging Het
Dgkb G A 12: 38,124,217 E181K probably benign Het
Dnase1 A T 16: 4,037,997 D64V probably damaging Het
E130308A19Rik T C 4: 59,719,767 I433T probably damaging Het
Ecsit C T 9: 22,076,296 R149H probably benign Het
Enpep A T 3: 129,305,516 V437E probably damaging Het
Esrp1 A T 4: 11,338,767 V679D probably damaging Het
Fa2h T A 8: 111,348,185 probably null Het
Fabp1 G A 6: 71,199,972 E16K probably damaging Het
Fstl5 T A 3: 76,707,503 S624T probably benign Het
Gemin5 G A 11: 58,128,860 R1128W probably benign Het
Gm8300 G A 12: 87,517,141 R82Q possibly damaging Het
Hist1h2bg T C 13: 23,571,667 S79P probably damaging Het
Hps3 T C 3: 20,003,328 H896R probably benign Het
Hsf1 T A 15: 76,498,281 I284K probably benign Het
Igkv3-2 T A 6: 70,699,004 I99N probably damaging Het
Iqub T A 6: 24,503,785 I163F possibly damaging Het
Jak2 T C 19: 29,298,332 I724T probably damaging Het
Kbtbd3 A T 9: 4,330,408 T261S probably benign Het
Kctd20 G T 17: 28,952,758 probably null Het
Kif28 C T 1: 179,709,449 V490M probably benign Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Klhl18 T C 9: 110,428,761 Y537C probably damaging Het
Mut T A 17: 40,943,893 I331K probably benign Het
Myo5a T A 9: 75,181,946 S1119R probably damaging Het
Napepld C A 5: 21,665,321 E366D probably benign Het
Nbea A G 3: 55,987,981 V1540A probably damaging Het
Neb T A 2: 52,221,726 I130L probably benign Het
Olfr18 C T 9: 20,314,645 D92N probably damaging Het
Olfr458 A T 6: 42,460,830 L63H probably damaging Het
Opcml T C 9: 28,813,344 V146A probably damaging Het
Pappa2 A C 1: 158,848,400 C925W probably damaging Het
Parp12 T A 6: 39,089,104 N562Y probably damaging Het
Patj C A 4: 98,538,964 H1198Q probably benign Het
Pcyox1 T A 6: 86,389,146 K362M possibly damaging Het
Pcyt2 T C 11: 120,610,939 Y350C probably benign Het
Pkd1 A T 17: 24,565,643 T388S probably benign Het
Prl3d1 T A 13: 27,100,028 Y193* probably null Het
Psme1 A T 14: 55,579,599 D15V possibly damaging Het
Qrsl1 G A 10: 43,874,635 R476C probably damaging Het
Ranbp2 A G 10: 58,479,619 N2054D probably damaging Het
Serpinb1c T A 13: 32,882,069 K298* probably null Het
Slc22a27 A T 19: 7,880,167 M355K probably benign Het
Spp1 T A 5: 104,440,414 H227Q probably benign Het
Stam2 T A 2: 52,719,773 N75I probably damaging Het
Tacc1 T C 8: 25,169,214 T579A probably benign Het
Tbx3 A G 5: 119,683,067 D734G probably benign Het
Tmem233 G T 5: 116,083,082 S35* probably null Het
Trim43c A T 9: 88,840,337 E12V probably damaging Het
Trio A G 15: 27,891,454 S463P unknown Het
Uggt2 A T 14: 119,026,422 D1065E probably damaging Het
Usp1 A G 4: 98,928,913 N114S probably benign Het
Usp34 A G 11: 23,446,787 E2377G Het
Virma T A 4: 11,528,643 H1243Q probably benign Het
Vmn2r3 A T 3: 64,271,293 V517D probably damaging Het
Zfp931 T C 2: 178,068,096 K166E probably damaging Het
Zp3 T A 5: 135,982,750 Y141N probably damaging Het
Other mutations in Olfr130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr130 APN 17 38068095 missense probably benign
IGL02158:Olfr130 APN 17 38067267 missense probably damaging 0.97
IGL03172:Olfr130 APN 17 38067384 missense probably damaging 0.99
R0389:Olfr130 UTSW 17 38067671 missense possibly damaging 0.58
R0448:Olfr130 UTSW 17 38067672 missense probably benign 0.00
R0616:Olfr130 UTSW 17 38067240 missense probably damaging 1.00
R0961:Olfr130 UTSW 17 38067923 missense probably damaging 1.00
R1789:Olfr130 UTSW 17 38067948 missense probably damaging 1.00
R2108:Olfr130 UTSW 17 38067855 missense possibly damaging 0.82
R4600:Olfr130 UTSW 17 38067962 missense probably damaging 0.99
R4977:Olfr130 UTSW 17 38067747 missense possibly damaging 0.67
R5120:Olfr130 UTSW 17 38067266 missense probably damaging 0.97
R5930:Olfr130 UTSW 17 38067750 missense probably benign 0.11
R6273:Olfr130 UTSW 17 38067795 missense probably damaging 1.00
R6636:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
R6637:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
R7030:Olfr130 UTSW 17 38068057 missense probably benign 0.13
R7045:Olfr130 UTSW 17 38067971 missense probably benign 0.01
R7175:Olfr130 UTSW 17 38067479 missense probably damaging 0.96
R7359:Olfr130 UTSW 17 38067615 nonsense probably null
R7762:Olfr130 UTSW 17 38067675 missense probably damaging 1.00
R7980:Olfr130 UTSW 17 38067521 missense possibly damaging 0.64
R9035:Olfr130 UTSW 17 38067288 missense probably benign 0.00
X0019:Olfr130 UTSW 17 38067722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTGCTGGTGCTAATCTCC -3'
(R):5'- TGGTACCCTGAATCAGAGTGTTG -3'

Sequencing Primer
(F):5'- TCCTGACACTGGTAGGCAAC -3'
(R):5'- TGAATCAGAGTGTTGCCCAC -3'
Posted On 2020-01-23