Incidental Mutation 'R8051:Lamb3'
ID619036
Institutional Source Beutler Lab
Gene Symbol Lamb3
Ensembl Gene ENSMUSG00000026639
Gene Namelaminin, beta 3
Synonymsnicein, 125kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R8051 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location193207699-193343878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 193330067 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 384 (V384A)
Ref Sequence ENSEMBL: ENSMUSP00000016315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016315] [ENSMUST00000159955] [ENSMUST00000192322] [ENSMUST00000194677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016315
AA Change: V384A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000016315
Gene: ENSMUSG00000026639
AA Change: V384A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159955
AA Change: V384A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123875
Gene: ENSMUSG00000026639
AA Change: V384A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192322
SMART Domains Protein: ENSMUSP00000141302
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 244 2.9e-80 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194677
AA Change: V384A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639
AA Change: V384A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous intracisternal A particle sequence insertion exhibit blistering of the skin and mucosal surfaces with abnormal hemidesmosomes. Mutants die neonatally, usually without feeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,273,412 probably benign Het
Acan T A 7: 79,100,779 L1766Q probably damaging Het
Adgrl3 A G 5: 81,465,266 Y114C probably damaging Het
Ano9 T A 7: 141,104,532 I472F probably damaging Het
Arhgap10 A G 8: 77,517,680 F35S probably damaging Het
Btnl2 T A 17: 34,363,499 D346E probably damaging Het
C4bp A T 1: 130,655,968 C88S probably damaging Het
Cavin2 A T 1: 51,301,124 Q320L probably benign Het
Chtf18 C A 17: 25,723,479 V462L probably benign Het
Crisp3 A T 17: 40,232,560 S134R probably benign Het
Dlg4 C A 11: 70,031,642 probably benign Het
Dsc3 A T 18: 19,981,213 M328K probably damaging Het
Efemp2 T A 19: 5,476,067 D73E probably damaging Het
Fbn1 C T 2: 125,306,463 A2622T possibly damaging Het
Flt1 T C 5: 147,582,691 H938R probably benign Het
Flt3 T G 5: 147,358,955 probably benign Het
Fnbp4 T C 2: 90,777,739 V935A possibly damaging Het
Frem2 T C 3: 53,535,355 N2587S probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gm36864 A T 7: 44,242,552 I385F probably benign Het
Il17re G T 6: 113,459,367 R47L probably benign Het
Il27ra A G 8: 84,033,949 probably null Het
Irf4 A G 13: 30,761,473 I401V probably damaging Het
Kat6a T C 8: 22,910,249 L342S probably damaging Het
Klc1 T A 12: 111,781,950 C390S possibly damaging Het
Klhl22 A T 16: 17,792,579 I565F probably damaging Het
Krt26 A T 11: 99,337,846 L20Q probably damaging Het
Lmo2 T A 2: 103,970,700 L80Q possibly damaging Het
Lrrc37a T G 11: 103,503,126 E491A possibly damaging Het
Ninj1 T A 13: 49,193,812 M51K probably damaging Het
Olfr109 G A 17: 37,466,322 G39R probably damaging Het
Olfr742 C A 14: 50,515,643 N146K probably benign Het
Plppr3 T A 10: 79,867,004 T142S probably damaging Het
Rab2b T C 14: 52,268,696 D103G probably damaging Het
Rap1gap2 G T 11: 74,395,825 R550S probably damaging Het
Rbm33 A G 5: 28,352,625 N279D probably damaging Het
Rhox9 C T X: 37,901,376 G40R probably benign Het
Selplg G A 5: 113,819,441 T268I probably damaging Het
Slc20a1 T C 2: 129,208,200 M426T possibly damaging Het
Spata18 A T 5: 73,669,720 Y220F Het
Spns1 T C 7: 126,372,536 T281A probably benign Het
Sptan1 C T 2: 30,030,159 R2288C probably damaging Het
Tacstd2 T C 6: 67,535,399 D103G probably damaging Het
Tmem121 C T 12: 113,188,867 A235V probably benign Het
Try4 A G 6: 41,305,062 D194G probably damaging Het
Tyrp1 C A 4: 80,837,660 T222K probably damaging Het
Zfp57 T A 17: 37,009,893 V213D probably damaging Het
Zfy2 A T Y: 2,117,380 probably benign Het
Zkscan4 G A 13: 21,484,653 G454R not run Het
Other mutations in Lamb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Lamb3 APN 1 193320447 missense probably damaging 1.00
IGL00898:Lamb3 APN 1 193338883 missense possibly damaging 0.81
IGL01599:Lamb3 APN 1 193343412 missense probably benign
IGL02108:Lamb3 APN 1 193332222 missense probably damaging 1.00
IGL02218:Lamb3 APN 1 193328633 critical splice acceptor site probably null
IGL02437:Lamb3 APN 1 193327945 missense probably damaging 1.00
IGL02659:Lamb3 APN 1 193332161 missense probably damaging 1.00
IGL02677:Lamb3 APN 1 193339522 missense probably benign 0.01
IGL02815:Lamb3 APN 1 193325555 splice site probably benign
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0265:Lamb3 UTSW 1 193320531 missense probably damaging 1.00
R0455:Lamb3 UTSW 1 193343392 missense probably damaging 0.99
R0647:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R0669:Lamb3 UTSW 1 193332330 missense probably damaging 1.00
R0826:Lamb3 UTSW 1 193330908 nonsense probably null
R1552:Lamb3 UTSW 1 193330759 splice site probably null
R1560:Lamb3 UTSW 1 193339402 missense probably benign 0.05
R1593:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R1599:Lamb3 UTSW 1 193320493 missense probably damaging 1.00
R1831:Lamb3 UTSW 1 193334879 missense probably damaging 0.99
R1848:Lamb3 UTSW 1 193334616 missense possibly damaging 0.96
R2117:Lamb3 UTSW 1 193334181 missense probably benign 0.00
R2147:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2148:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2879:Lamb3 UTSW 1 193330784 missense possibly damaging 0.67
R3019:Lamb3 UTSW 1 193331409 critical splice donor site probably null
R4380:Lamb3 UTSW 1 193331375 missense probably benign 0.10
R4648:Lamb3 UTSW 1 193331357 missense probably damaging 0.99
R4758:Lamb3 UTSW 1 193339961 missense possibly damaging 0.65
R4790:Lamb3 UTSW 1 193339886 missense probably damaging 1.00
R4895:Lamb3 UTSW 1 193332314 nonsense probably null
R5316:Lamb3 UTSW 1 193330193 missense probably benign 0.00
R5457:Lamb3 UTSW 1 193325994 missense probably damaging 1.00
R5952:Lamb3 UTSW 1 193332362 missense probably benign 0.04
R5965:Lamb3 UTSW 1 193343460 missense probably damaging 1.00
R6334:Lamb3 UTSW 1 193335474 missense probably damaging 0.96
R6522:Lamb3 UTSW 1 193335453 missense probably benign 0.01
R6725:Lamb3 UTSW 1 193304582 missense probably benign 0.05
R6791:Lamb3 UTSW 1 193334861 missense possibly damaging 0.93
R6828:Lamb3 UTSW 1 193335448 missense probably benign 0.00
R7143:Lamb3 UTSW 1 193304565 missense probably damaging 1.00
R7329:Lamb3 UTSW 1 193320540 missense possibly damaging 0.89
R7439:Lamb3 UTSW 1 193332166 missense possibly damaging 0.80
R7556:Lamb3 UTSW 1 193332449 missense probably benign
R8220:Lamb3 UTSW 1 193334248 missense probably damaging 1.00
X0066:Lamb3 UTSW 1 193339414 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGTCCTTTTCTCACGTGACAG -3'
(R):5'- TCCCTGTGAGGAGAACACTC -3'

Sequencing Primer
(F):5'- CGTGACAGACGGGGAGAC -3'
(R):5'- ACAAGGCTCGGTCTGGTAG -3'
Posted On2020-01-23