Incidental Mutation 'R8051:Sptan1'
ID 619037
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Name spectrin alpha, non-erythrocytic 1
Synonyms alpha-fodrin, alphaII-spectrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 067488-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8051 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 29855572-29921463 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 29920171 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 2288 (R2288C)
Ref Sequence ENSEMBL: ENSMUSP00000109346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113711] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
AlphaFold P16546
Predicted Effect probably damaging
Transcript: ENSMUST00000046257
AA Change: R2283C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: R2283C

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095083
AA Change: R2303C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: R2303C

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100225
AA Change: R2308C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: R2308C

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113711
SMART Domains Protein: ENSMUSP00000109340
Gene: ENSMUSG00000039715

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
low complexity region 90 100 N/A INTRINSIC
Blast:WD40 146 200 3e-28 BLAST
WD40 207 247 2e-1 SMART
WD40 256 300 3.42e1 SMART
Blast:WD40 323 364 8e-10 BLAST
WD40 382 422 1.66e-5 SMART
WD40 425 465 3.09e-1 SMART
WD40 470 512 4.18e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113717
AA Change: R2288C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: R2288C

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113719
AA Change: R2309C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: R2309C

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129241
AA Change: R2329C
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: R2329C

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Meta Mutation Damage Score 0.8866 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 78,750,527 (GRCm39) L1766Q probably damaging Het
Adgrl3 A G 5: 81,613,113 (GRCm39) Y114C probably damaging Het
Ano9 T A 7: 140,684,445 (GRCm39) I472F probably damaging Het
Arhgap10 A G 8: 78,244,309 (GRCm39) F35S probably damaging Het
Bltp2 G A 11: 78,164,238 (GRCm39) probably benign Het
Btnl2 T A 17: 34,582,473 (GRCm39) D346E probably damaging Het
C4bp A T 1: 130,583,705 (GRCm39) C88S probably damaging Het
Cavin2 A T 1: 51,340,283 (GRCm39) Q320L probably benign Het
Chtf18 C A 17: 25,942,453 (GRCm39) V462L probably benign Het
Crisp3 A T 17: 40,543,451 (GRCm39) S134R probably benign Het
Dlg4 C A 11: 69,922,468 (GRCm39) probably benign Het
Dsc3 A T 18: 20,114,270 (GRCm39) M328K probably damaging Het
Efemp2 T A 19: 5,526,095 (GRCm39) D73E probably damaging Het
Fbn1 C T 2: 125,148,383 (GRCm39) A2622T possibly damaging Het
Flt1 T C 5: 147,519,501 (GRCm39) H938R probably benign Het
Flt3 T G 5: 147,295,765 (GRCm39) probably benign Het
Fnbp4 T C 2: 90,608,083 (GRCm39) V935A possibly damaging Het
Frem2 T C 3: 53,442,776 (GRCm39) N2587S probably benign Het
Gabbr2 C T 4: 46,736,349 (GRCm39) probably null Het
Gm36864 A T 7: 43,891,976 (GRCm39) I385F probably benign Het
Il17re G T 6: 113,436,328 (GRCm39) R47L probably benign Het
Il27ra A G 8: 84,760,578 (GRCm39) probably null Het
Irf4 A G 13: 30,945,456 (GRCm39) I401V probably damaging Het
Kat6a T C 8: 23,400,265 (GRCm39) L342S probably damaging Het
Klc1 T A 12: 111,748,384 (GRCm39) C390S possibly damaging Het
Klhl22 A T 16: 17,610,443 (GRCm39) I565F probably damaging Het
Krt26 A T 11: 99,228,672 (GRCm39) L20Q probably damaging Het
Lamb3 T C 1: 193,012,375 (GRCm39) V384A possibly damaging Het
Lmo2 T A 2: 103,801,045 (GRCm39) L80Q possibly damaging Het
Lrrc37a T G 11: 103,393,952 (GRCm39) E491A possibly damaging Het
Ninj1 T A 13: 49,347,288 (GRCm39) M51K probably damaging Het
Or11g26 C A 14: 50,753,100 (GRCm39) N146K probably benign Het
Or12d17 G A 17: 37,777,213 (GRCm39) G39R probably damaging Het
Plppr3 T A 10: 79,702,838 (GRCm39) T142S probably damaging Het
Rab2b T C 14: 52,506,153 (GRCm39) D103G probably damaging Het
Rap1gap2 G T 11: 74,286,651 (GRCm39) R550S probably damaging Het
Rbm33 A G 5: 28,557,623 (GRCm39) N279D probably damaging Het
Rhox9 C T X: 36,990,253 (GRCm39) G40R probably benign Het
Selplg G A 5: 113,957,502 (GRCm39) T268I probably damaging Het
Slc20a1 T C 2: 129,050,120 (GRCm39) M426T possibly damaging Het
Spata18 A T 5: 73,827,063 (GRCm39) Y220F Het
Spns1 T C 7: 125,971,708 (GRCm39) T281A probably benign Het
Tacstd2 T C 6: 67,512,383 (GRCm39) D103G probably damaging Het
Tmem121 C T 12: 113,152,487 (GRCm39) A235V probably benign Het
Try4 A G 6: 41,281,996 (GRCm39) D194G probably damaging Het
Tyrp1 C A 4: 80,755,897 (GRCm39) T222K probably damaging Het
Zfp57 T A 17: 37,320,785 (GRCm39) V213D probably damaging Het
Zfy2 A T Y: 2,117,380 (GRCm39) probably benign Het
Zkscan4 G A 13: 21,668,823 (GRCm39) G454R not run Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29,883,968 (GRCm39) critical splice donor site probably null
IGL00932:Sptan1 APN 2 29,905,622 (GRCm39) missense probably damaging 1.00
IGL00945:Sptan1 APN 2 29,890,083 (GRCm39) splice site probably benign
IGL01070:Sptan1 APN 2 29,904,185 (GRCm39) critical splice donor site probably null
IGL01625:Sptan1 APN 2 29,916,126 (GRCm39) missense probably damaging 1.00
IGL01657:Sptan1 APN 2 29,908,491 (GRCm39) missense probably benign 0.12
IGL01795:Sptan1 APN 2 29,908,501 (GRCm39) missense probably benign 0.07
IGL01982:Sptan1 APN 2 29,909,980 (GRCm39) missense probably damaging 1.00
IGL02040:Sptan1 APN 2 29,903,725 (GRCm39) missense probably benign 0.43
IGL02158:Sptan1 APN 2 29,920,336 (GRCm39) missense probably damaging 0.97
IGL02370:Sptan1 APN 2 29,920,752 (GRCm39) missense probably damaging 0.99
IGL02507:Sptan1 APN 2 29,906,067 (GRCm39) missense probably damaging 1.00
IGL02552:Sptan1 APN 2 29,908,486 (GRCm39) missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29,888,195 (GRCm39) missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29,868,588 (GRCm39) missense probably benign 0.03
IGL02725:Sptan1 APN 2 29,886,055 (GRCm39) missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29,881,045 (GRCm39) missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29,876,505 (GRCm39) missense probably damaging 1.00
IGL03405:Sptan1 APN 2 29,915,593 (GRCm39) missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0094:Sptan1 UTSW 2 29,896,635 (GRCm39) missense probably benign 0.37
R0230:Sptan1 UTSW 2 29,900,704 (GRCm39) splice site probably benign
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0366:Sptan1 UTSW 2 29,882,764 (GRCm39) splice site probably null
R0368:Sptan1 UTSW 2 29,883,927 (GRCm39) missense probably benign 0.29
R0396:Sptan1 UTSW 2 29,881,045 (GRCm39) missense probably damaging 1.00
R0423:Sptan1 UTSW 2 29,918,684 (GRCm39) missense probably null
R0448:Sptan1 UTSW 2 29,916,822 (GRCm39) missense probably damaging 1.00
R0485:Sptan1 UTSW 2 29,903,860 (GRCm39) splice site probably benign
R0580:Sptan1 UTSW 2 29,897,587 (GRCm39) missense probably damaging 0.99
R0739:Sptan1 UTSW 2 29,903,530 (GRCm39) missense probably damaging 1.00
R0924:Sptan1 UTSW 2 29,906,040 (GRCm39) missense probably damaging 0.98
R0930:Sptan1 UTSW 2 29,906,040 (GRCm39) missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29,870,075 (GRCm39) splice site probably null
R1352:Sptan1 UTSW 2 29,911,199 (GRCm39) splice site probably benign
R1456:Sptan1 UTSW 2 29,870,215 (GRCm39) critical splice donor site probably null
R1537:Sptan1 UTSW 2 29,916,034 (GRCm39) missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 29,917,139 (GRCm39) missense probably damaging 1.00
R1612:Sptan1 UTSW 2 29,893,348 (GRCm39) missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29,876,432 (GRCm39) missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29,882,013 (GRCm39) splice site probably benign
R1879:Sptan1 UTSW 2 29,885,540 (GRCm39) missense probably damaging 1.00
R1893:Sptan1 UTSW 2 29,910,472 (GRCm39) missense probably damaging 0.98
R1914:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R1915:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R2022:Sptan1 UTSW 2 29,897,573 (GRCm39) missense probably damaging 0.96
R2050:Sptan1 UTSW 2 29,892,250 (GRCm39) missense probably benign
R2103:Sptan1 UTSW 2 29,920,483 (GRCm39) missense probably damaging 1.00
R2162:Sptan1 UTSW 2 29,908,588 (GRCm39) splice site probably benign
R2931:Sptan1 UTSW 2 29,908,500 (GRCm39) missense probably benign
R3726:Sptan1 UTSW 2 29,908,431 (GRCm39) missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 29,920,037 (GRCm39) missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 29,916,600 (GRCm39) missense probably damaging 1.00
R4378:Sptan1 UTSW 2 29,915,581 (GRCm39) missense probably damaging 1.00
R4424:Sptan1 UTSW 2 29,919,721 (GRCm39) intron probably benign
R4718:Sptan1 UTSW 2 29,921,074 (GRCm39) missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29,886,447 (GRCm39) missense probably damaging 0.98
R4849:Sptan1 UTSW 2 29,901,054 (GRCm39) missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29,868,455 (GRCm39) missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5181:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5383:Sptan1 UTSW 2 29,901,340 (GRCm39) missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29,876,504 (GRCm39) nonsense probably null
R5592:Sptan1 UTSW 2 29,876,731 (GRCm39) intron probably benign
R5639:Sptan1 UTSW 2 29,881,005 (GRCm39) nonsense probably null
R5801:Sptan1 UTSW 2 29,920,613 (GRCm39) splice site probably null
R5947:Sptan1 UTSW 2 29,884,379 (GRCm39) critical splice donor site probably null
R6056:Sptan1 UTSW 2 29,886,794 (GRCm39) missense probably benign 0.36
R6090:Sptan1 UTSW 2 29,883,899 (GRCm39) missense probably damaging 1.00
R6146:Sptan1 UTSW 2 29,894,535 (GRCm39) missense probably benign 0.01
R6254:Sptan1 UTSW 2 29,897,561 (GRCm39) missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 29,910,467 (GRCm39) missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 29,908,527 (GRCm39) missense probably damaging 1.00
R6521:Sptan1 UTSW 2 29,910,467 (GRCm39) missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 29,920,985 (GRCm39) missense probably damaging 0.99
R7173:Sptan1 UTSW 2 29,873,221 (GRCm39) missense probably benign 0.02
R7248:Sptan1 UTSW 2 29,892,311 (GRCm39) missense probably benign 0.10
R7282:Sptan1 UTSW 2 29,876,941 (GRCm39) missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29,870,209 (GRCm39) missense probably damaging 1.00
R7585:Sptan1 UTSW 2 29,890,068 (GRCm39) missense probably benign 0.06
R7779:Sptan1 UTSW 2 29,911,319 (GRCm39) missense probably damaging 1.00
R8055:Sptan1 UTSW 2 29,884,351 (GRCm39) missense probably benign 0.22
R8103:Sptan1 UTSW 2 29,910,055 (GRCm39) missense probably damaging 1.00
R8283:Sptan1 UTSW 2 29,870,212 (GRCm39) missense probably damaging 1.00
R8507:Sptan1 UTSW 2 29,916,596 (GRCm39) missense probably damaging 1.00
R8963:Sptan1 UTSW 2 29,873,744 (GRCm39) missense possibly damaging 0.92
R9126:Sptan1 UTSW 2 29,920,597 (GRCm39) missense probably damaging 0.99
R9206:Sptan1 UTSW 2 29,920,724 (GRCm39) missense possibly damaging 0.90
R9273:Sptan1 UTSW 2 29,880,977 (GRCm39) missense possibly damaging 0.88
X0028:Sptan1 UTSW 2 29,910,042 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCCACCCAATAAGCG -3'
(R):5'- CCTGGGCCATACTCACTTGAAC -3'

Sequencing Primer
(F):5'- CGCAAGCACCAGGAGATTCG -3'
(R):5'- GAACATCATGCTGAATTCCTTGAGGG -3'
Posted On 2020-01-23