Incidental Mutation 'R8051:Flt1'
ID619048
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8051 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147582691 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 938 (H938R)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653]
Predicted Effect probably benign
Transcript: ENSMUST00000031653
AA Change: H938R

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: H938R

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,273,412 probably benign Het
Acan T A 7: 79,100,779 L1766Q probably damaging Het
Adgrl3 A G 5: 81,465,266 Y114C probably damaging Het
Ano9 T A 7: 141,104,532 I472F probably damaging Het
Arhgap10 A G 8: 77,517,680 F35S probably damaging Het
Btnl2 T A 17: 34,363,499 D346E probably damaging Het
C4bp A T 1: 130,655,968 C88S probably damaging Het
Cavin2 A T 1: 51,301,124 Q320L probably benign Het
Chtf18 C A 17: 25,723,479 V462L probably benign Het
Crisp3 A T 17: 40,232,560 S134R probably benign Het
Dlg4 C A 11: 70,031,642 probably benign Het
Dsc3 A T 18: 19,981,213 M328K probably damaging Het
Efemp2 T A 19: 5,476,067 D73E probably damaging Het
Fbn1 C T 2: 125,306,463 A2622T possibly damaging Het
Flt3 T G 5: 147,358,955 probably benign Het
Fnbp4 T C 2: 90,777,739 V935A possibly damaging Het
Frem2 T C 3: 53,535,355 N2587S probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gm36864 A T 7: 44,242,552 I385F probably benign Het
Il17re G T 6: 113,459,367 R47L probably benign Het
Il27ra A G 8: 84,033,949 probably null Het
Irf4 A G 13: 30,761,473 I401V probably damaging Het
Kat6a T C 8: 22,910,249 L342S probably damaging Het
Klc1 T A 12: 111,781,950 C390S possibly damaging Het
Klhl22 A T 16: 17,792,579 I565F probably damaging Het
Krt26 A T 11: 99,337,846 L20Q probably damaging Het
Lamb3 T C 1: 193,330,067 V384A possibly damaging Het
Lmo2 T A 2: 103,970,700 L80Q possibly damaging Het
Lrrc37a T G 11: 103,503,126 E491A possibly damaging Het
Ninj1 T A 13: 49,193,812 M51K probably damaging Het
Olfr109 G A 17: 37,466,322 G39R probably damaging Het
Olfr742 C A 14: 50,515,643 N146K probably benign Het
Plppr3 T A 10: 79,867,004 T142S probably damaging Het
Rab2b T C 14: 52,268,696 D103G probably damaging Het
Rap1gap2 G T 11: 74,395,825 R550S probably damaging Het
Rbm33 A G 5: 28,352,625 N279D probably damaging Het
Rhox9 C T X: 37,901,376 G40R probably benign Het
Selplg G A 5: 113,819,441 T268I probably damaging Het
Slc20a1 T C 2: 129,208,200 M426T possibly damaging Het
Spata18 A T 5: 73,669,720 Y220F Het
Spns1 T C 7: 126,372,536 T281A probably benign Het
Sptan1 C T 2: 30,030,159 R2288C probably damaging Het
Tacstd2 T C 6: 67,535,399 D103G probably damaging Het
Tmem121 C T 12: 113,188,867 A235V probably benign Het
Try4 A G 6: 41,305,062 D194G probably damaging Het
Tyrp1 C A 4: 80,837,660 T222K probably damaging Het
Zfp57 T A 17: 37,009,893 V213D probably damaging Het
Zfy2 A T Y: 2,117,380 probably benign Het
Zkscan4 G A 13: 21,484,653 G454R not run Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGAAATCCCCGAGACTGGAG -3'
(R):5'- TGCTAGCTCACACTAAGTGTTCAG -3'

Sequencing Primer
(F):5'- AGACTGGAGGCCGGGAG -3'
(R):5'- CAGTATTTATCAGTTGCCTGGATC -3'
Posted On2020-01-23