Incidental Mutation 'R8051:Try4'
ID619049
Institutional Source Beutler Lab
Gene Symbol Try4
Ensembl Gene ENSMUSG00000054106
Gene Nametrypsin 4
Synonyms0910001B19Rik, Td
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8051 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location41302269-41305532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41305062 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 194 (D194G)
Ref Sequence ENSEMBL: ENSMUSP00000031913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031913]
Predicted Effect probably damaging
Transcript: ENSMUST00000031913
AA Change: D194G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031913
Gene: ENSMUSG00000054106
AA Change: D194G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Tryp_SPc 23 239 9.72e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,273,412 probably benign Het
Acan T A 7: 79,100,779 L1766Q probably damaging Het
Adgrl3 A G 5: 81,465,266 Y114C probably damaging Het
Ano9 T A 7: 141,104,532 I472F probably damaging Het
Arhgap10 A G 8: 77,517,680 F35S probably damaging Het
Btnl2 T A 17: 34,363,499 D346E probably damaging Het
C4bp A T 1: 130,655,968 C88S probably damaging Het
Cavin2 A T 1: 51,301,124 Q320L probably benign Het
Chtf18 C A 17: 25,723,479 V462L probably benign Het
Crisp3 A T 17: 40,232,560 S134R probably benign Het
Dlg4 C A 11: 70,031,642 probably benign Het
Dsc3 A T 18: 19,981,213 M328K probably damaging Het
Efemp2 T A 19: 5,476,067 D73E probably damaging Het
Fbn1 C T 2: 125,306,463 A2622T possibly damaging Het
Flt1 T C 5: 147,582,691 H938R probably benign Het
Flt3 T G 5: 147,358,955 probably benign Het
Fnbp4 T C 2: 90,777,739 V935A possibly damaging Het
Frem2 T C 3: 53,535,355 N2587S probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gm36864 A T 7: 44,242,552 I385F probably benign Het
Il17re G T 6: 113,459,367 R47L probably benign Het
Il27ra A G 8: 84,033,949 probably null Het
Irf4 A G 13: 30,761,473 I401V probably damaging Het
Kat6a T C 8: 22,910,249 L342S probably damaging Het
Klc1 T A 12: 111,781,950 C390S possibly damaging Het
Klhl22 A T 16: 17,792,579 I565F probably damaging Het
Krt26 A T 11: 99,337,846 L20Q probably damaging Het
Lamb3 T C 1: 193,330,067 V384A possibly damaging Het
Lmo2 T A 2: 103,970,700 L80Q possibly damaging Het
Lrrc37a T G 11: 103,503,126 E491A possibly damaging Het
Ninj1 T A 13: 49,193,812 M51K probably damaging Het
Olfr109 G A 17: 37,466,322 G39R probably damaging Het
Olfr742 C A 14: 50,515,643 N146K probably benign Het
Plppr3 T A 10: 79,867,004 T142S probably damaging Het
Rab2b T C 14: 52,268,696 D103G probably damaging Het
Rap1gap2 G T 11: 74,395,825 R550S probably damaging Het
Rbm33 A G 5: 28,352,625 N279D probably damaging Het
Rhox9 C T X: 37,901,376 G40R probably benign Het
Selplg G A 5: 113,819,441 T268I probably damaging Het
Slc20a1 T C 2: 129,208,200 M426T possibly damaging Het
Spata18 A T 5: 73,669,720 Y220F Het
Spns1 T C 7: 126,372,536 T281A probably benign Het
Sptan1 C T 2: 30,030,159 R2288C probably damaging Het
Tacstd2 T C 6: 67,535,399 D103G probably damaging Het
Tmem121 C T 12: 113,188,867 A235V probably benign Het
Tyrp1 C A 4: 80,837,660 T222K probably damaging Het
Zfp57 T A 17: 37,009,893 V213D probably damaging Het
Zfy2 A T Y: 2,117,380 probably benign Het
Zkscan4 G A 13: 21,484,653 G454R not run Het
Other mutations in Try4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Try4 APN 6 41305026 missense probably damaging 1.00
IGL02216:Try4 APN 6 41305031 missense probably benign
R0537:Try4 UTSW 6 41304362 missense probably benign
R0731:Try4 UTSW 6 41304367 missense probably benign 0.01
R1113:Try4 UTSW 6 41305374 missense possibly damaging 0.90
R1833:Try4 UTSW 6 41303431 missense probably damaging 0.98
R2246:Try4 UTSW 6 41305472 missense possibly damaging 0.80
R4131:Try4 UTSW 6 41305401 nonsense probably null
R4414:Try4 UTSW 6 41304971 missense possibly damaging 0.84
R5457:Try4 UTSW 6 41303421 missense probably damaging 1.00
R5707:Try4 UTSW 6 41305043 missense possibly damaging 0.65
R6023:Try4 UTSW 6 41303421 missense probably damaging 1.00
R7131:Try4 UTSW 6 41304403 missense probably benign 0.03
R7783:Try4 UTSW 6 41302295 missense possibly damaging 0.96
RF007:Try4 UTSW 6 41305363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTGTAGACTTTCTCCACTGG -3'
(R):5'- AGATGCCATTCTAGCCATGC -3'

Sequencing Primer
(F):5'- CACTGGAATATTAATGTCTATCCTGG -3'
(R):5'- ATGCCATTCTAGCCATGCTTTGC -3'
Posted On2020-01-23