Incidental Mutation 'R0662:Shprh'
ID 61907
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 038847-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0662 (G1)
Quality Score 118
Status Not validated
Chromosome 10
Chromosomal Location 11025171-11093339 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 11062591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1233 (V1233I)
Ref Sequence ENSEMBL: ENSMUSP00000132870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: V1233I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: V1233I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054814
AA Change: V1233I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: V1233I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: V1233I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: V1233I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159553
Predicted Effect probably benign
Transcript: ENSMUST00000159810
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,898,338 (GRCm39) S241P probably benign Het
Ankrd53 G T 6: 83,740,625 (GRCm39) V83L probably damaging Het
Armcx2 G A X: 133,706,385 (GRCm39) T416I possibly damaging Het
C4b G A 17: 34,949,862 (GRCm39) R1441C probably damaging Het
Cacng3 T C 7: 122,367,582 (GRCm39) I154T probably damaging Het
Cand2 A G 6: 115,764,171 (GRCm39) D315G probably benign Het
Celsr2 A T 3: 108,305,836 (GRCm39) S2089R probably damaging Het
Chd9 A C 8: 91,704,304 (GRCm39) K247Q probably damaging Het
Chi3l1 A C 1: 134,116,311 (GRCm39) S263R probably damaging Het
Clec12b A C 6: 129,353,200 (GRCm39) C262W probably damaging Het
Cpsf7 T C 19: 10,503,372 (GRCm39) M1T probably null Het
Cul3 T C 1: 80,249,282 (GRCm39) D597G probably damaging Het
Dcaf11 T C 14: 55,802,964 (GRCm39) V251A possibly damaging Het
Dennd2b G T 7: 109,156,633 (GRCm39) P39Q probably damaging Het
Eno2 A T 6: 124,740,774 (GRCm39) F218I probably damaging Het
Frmd6 A T 12: 70,946,218 (GRCm39) R549* probably null Het
Fyb2 G A 4: 104,852,895 (GRCm39) S461N possibly damaging Het
Gm5709 A T 3: 59,514,164 (GRCm39) noncoding transcript Het
Hormad1 T C 3: 95,482,910 (GRCm39) I132T probably benign Het
Itga7 G T 10: 128,789,400 (GRCm39) R981L probably damaging Het
Itgbl1 T A 14: 124,065,306 (GRCm39) N153K probably damaging Het
Itih1 T C 14: 30,655,317 (GRCm39) E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,712,417 (GRCm39) probably benign Het
Kcna2 A T 3: 107,012,717 (GRCm39) T433S probably benign Het
Map4k5 A G 12: 69,859,927 (GRCm39) V673A probably damaging Het
Mmp27 T A 9: 7,577,651 (GRCm39) V281E probably benign Het
Nr2c1 A T 10: 94,026,600 (GRCm39) I492F probably damaging Het
Or14c39 A G 7: 86,343,838 (GRCm39) Y58C possibly damaging Het
Or2ag19 A T 7: 106,443,856 (GRCm39) I13F probably benign Het
Or2r3 C T 6: 42,448,708 (GRCm39) V135M possibly damaging Het
Or2y3 A G 17: 38,393,824 (GRCm39) I15T probably benign Het
Or7d10 G C 9: 19,831,796 (GRCm39) C97S probably damaging Het
Or7e170 T C 9: 19,795,248 (GRCm39) M118V probably benign Het
Or8b47 T A 9: 38,435,322 (GRCm39) M98K probably damaging Het
Pank3 T C 11: 35,669,477 (GRCm39) M237T probably damaging Het
Plekhh1 A G 12: 79,125,767 (GRCm39) T1268A probably benign Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Rhcg C T 7: 79,249,477 (GRCm39) V310M probably damaging Het
Ryr1 A T 7: 28,799,614 (GRCm39) D906E probably damaging Het
Sez6l A T 5: 112,621,288 (GRCm39) L262Q probably damaging Het
Slc3a1 A G 17: 85,344,635 (GRCm39) E267G possibly damaging Het
Slc5a5 T A 8: 71,336,519 (GRCm39) T616S probably benign Het
Syne3 T G 12: 104,927,769 (GRCm39) E318A probably benign Het
Tecpr2 A G 12: 110,862,662 (GRCm39) T25A probably benign Het
Ubxn1 T A 19: 8,852,561 (GRCm39) probably null Het
Unc5b C A 10: 60,608,362 (GRCm39) R616L possibly damaging Het
Ush2a A G 1: 188,083,290 (GRCm39) T278A probably benign Het
Utp14b A G 1: 78,642,716 (GRCm39) T205A probably damaging Het
Vmn1r219 T C 13: 23,347,623 (GRCm39) S271P possibly damaging Het
Vmn2r76 C T 7: 85,879,578 (GRCm39) V241M probably benign Het
Zbtb24 G A 10: 41,338,275 (GRCm39) G429D probably damaging Het
Zdhhc2 T C 8: 40,900,139 (GRCm39) S68P probably damaging Het
Zfp719 G A 7: 43,233,678 (GRCm39) M32I possibly damaging Het
Zfp975 T C 7: 42,311,950 (GRCm39) N221S probably benign Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,063,902 (GRCm39) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,063,764 (GRCm39) missense probably benign 0.37
IGL00684:Shprh APN 10 11,038,781 (GRCm39) missense probably benign 0.11
IGL01295:Shprh APN 10 11,059,612 (GRCm39) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,045,998 (GRCm39) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,045,763 (GRCm39) nonsense probably null
IGL01833:Shprh APN 10 11,066,806 (GRCm39) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,057,246 (GRCm39) splice site probably benign
IGL02502:Shprh APN 10 11,070,101 (GRCm39) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,030,509 (GRCm39) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,068,238 (GRCm39) frame shift probably null
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0255:Shprh UTSW 10 11,062,135 (GRCm39) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,045,853 (GRCm39) missense probably benign 0.00
R0331:Shprh UTSW 10 11,069,914 (GRCm39) splice site probably benign
R0494:Shprh UTSW 10 11,032,935 (GRCm39) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,038,556 (GRCm39) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,059,631 (GRCm39) splice site probably benign
R0574:Shprh UTSW 10 11,038,821 (GRCm39) unclassified probably benign
R0605:Shprh UTSW 10 11,082,856 (GRCm39) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,035,274 (GRCm39) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,040,488 (GRCm39) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,032,822 (GRCm39) missense probably benign
R1830:Shprh UTSW 10 11,062,655 (GRCm39) splice site probably null
R1898:Shprh UTSW 10 11,062,613 (GRCm39) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,059,541 (GRCm39) nonsense probably null
R2060:Shprh UTSW 10 11,027,864 (GRCm39) missense probably benign 0.03
R2225:Shprh UTSW 10 11,037,979 (GRCm39) unclassified probably benign
R2363:Shprh UTSW 10 11,047,697 (GRCm39) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,042,468 (GRCm39) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,040,100 (GRCm39) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,046,157 (GRCm39) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,045,774 (GRCm39) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,054,501 (GRCm39) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,083,604 (GRCm39) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,062,262 (GRCm39) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,036,215 (GRCm39) missense probably benign 0.17
R4748:Shprh UTSW 10 11,046,220 (GRCm39) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,057,284 (GRCm39) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,040,301 (GRCm39) missense probably benign 0.00
R4937:Shprh UTSW 10 11,032,863 (GRCm39) missense probably benign
R5140:Shprh UTSW 10 11,030,449 (GRCm39) missense probably benign 0.03
R5318:Shprh UTSW 10 11,042,301 (GRCm39) missense probably benign 0.04
R5323:Shprh UTSW 10 11,046,041 (GRCm39) splice site probably null
R5450:Shprh UTSW 10 11,088,074 (GRCm39) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,063,817 (GRCm39) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6392:Shprh UTSW 10 11,054,485 (GRCm39) nonsense probably null
R6416:Shprh UTSW 10 11,043,617 (GRCm39) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,047,681 (GRCm39) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,062,637 (GRCm39) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,070,011 (GRCm39) missense probably benign 0.02
R6678:Shprh UTSW 10 11,042,289 (GRCm39) missense probably benign 0.16
R6757:Shprh UTSW 10 11,057,252 (GRCm39) splice site probably null
R6971:Shprh UTSW 10 11,042,437 (GRCm39) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,042,474 (GRCm39) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,040,449 (GRCm39) missense probably benign
R7757:Shprh UTSW 10 11,037,924 (GRCm39) missense probably benign 0.30
R7812:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign
R7998:Shprh UTSW 10 11,061,085 (GRCm39) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,088,077 (GRCm39) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,027,555 (GRCm39) missense probably benign 0.22
R8116:Shprh UTSW 10 11,089,205 (GRCm39) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,063,727 (GRCm39) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,057,313 (GRCm39) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,027,678 (GRCm39) missense probably benign 0.37
R8759:Shprh UTSW 10 11,032,908 (GRCm39) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,061,181 (GRCm39) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,040,574 (GRCm39) nonsense probably null
R9053:Shprh UTSW 10 11,030,446 (GRCm39) missense probably benign 0.04
R9131:Shprh UTSW 10 11,038,589 (GRCm39) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,036,320 (GRCm39) missense probably benign 0.02
R9391:Shprh UTSW 10 11,038,633 (GRCm39) missense probably benign 0.05
R9423:Shprh UTSW 10 11,081,007 (GRCm39) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,042,235 (GRCm39) nonsense probably null
R9668:Shprh UTSW 10 11,082,076 (GRCm39) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,038,574 (GRCm39) missense possibly damaging 0.91
R9718:Shprh UTSW 10 11,089,248 (GRCm39) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,040,204 (GRCm39) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,040,585 (GRCm39) missense probably benign 0.02
V8831:Shprh UTSW 10 11,062,606 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,062,191 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,040,297 (GRCm39) missense probably benign
Z1177:Shprh UTSW 10 11,027,506 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAGTCTGCAACAGTTTGCCACC -3'
(R):5'- AATTTGCTCTTGACAGTGTTCAGGGAT -3'

Sequencing Primer
(F):5'- CCGCATGATCTCAGAAATGGTTG -3'
(R):5'- TGGGCATGTTAAATCCCAAAGG -3'
Posted On 2013-07-30