Incidental Mutation 'R8051:Klhl22'
ID619070
Institutional Source Beutler Lab
Gene Symbol Klhl22
Ensembl Gene ENSMUSG00000022750
Gene Namekelch-like 22
SynonymsKelchl, 2610318I18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R8051 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17759618-17793382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17792579 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 565 (I565F)
Ref Sequence ENSEMBL: ENSMUSP00000112412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012161] [ENSMUST00000120488] [ENSMUST00000165790] [ENSMUST00000232577]
Predicted Effect probably benign
Transcript: ENSMUST00000012161
SMART Domains Protein: ENSMUSP00000012161
Gene: ENSMUSG00000012017

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 71 102 4.56e0 SMART
EGF 113 145 2.43e1 SMART
EGF 147 174 2.03e1 SMART
EGF_like 207 233 1.68e0 SMART
EGF 235 262 1.73e1 SMART
EGF_like 309 352 2.86e1 SMART
EGF_like 323 364 4.97e0 SMART
EGF_like 367 407 8.13e-1 SMART
low complexity region 437 459 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 597 606 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
low complexity region 636 656 N/A INTRINSIC
low complexity region 665 685 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120488
AA Change: I565F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112412
Gene: ENSMUSG00000022750
AA Change: I565F

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165790
AA Change: I565F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127227
Gene: ENSMUSG00000022750
AA Change: I565F

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232577
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,273,412 probably benign Het
Acan T A 7: 79,100,779 L1766Q probably damaging Het
Adgrl3 A G 5: 81,465,266 Y114C probably damaging Het
Ano9 T A 7: 141,104,532 I472F probably damaging Het
Arhgap10 A G 8: 77,517,680 F35S probably damaging Het
Btnl2 T A 17: 34,363,499 D346E probably damaging Het
C4bp A T 1: 130,655,968 C88S probably damaging Het
Cavin2 A T 1: 51,301,124 Q320L probably benign Het
Chtf18 C A 17: 25,723,479 V462L probably benign Het
Crisp3 A T 17: 40,232,560 S134R probably benign Het
Dlg4 C A 11: 70,031,642 probably benign Het
Dsc3 A T 18: 19,981,213 M328K probably damaging Het
Efemp2 T A 19: 5,476,067 D73E probably damaging Het
Fbn1 C T 2: 125,306,463 A2622T possibly damaging Het
Flt1 T C 5: 147,582,691 H938R probably benign Het
Flt3 T G 5: 147,358,955 probably benign Het
Fnbp4 T C 2: 90,777,739 V935A possibly damaging Het
Frem2 T C 3: 53,535,355 N2587S probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gm36864 A T 7: 44,242,552 I385F probably benign Het
Il17re G T 6: 113,459,367 R47L probably benign Het
Il27ra A G 8: 84,033,949 probably null Het
Irf4 A G 13: 30,761,473 I401V probably damaging Het
Kat6a T C 8: 22,910,249 L342S probably damaging Het
Klc1 T A 12: 111,781,950 C390S possibly damaging Het
Krt26 A T 11: 99,337,846 L20Q probably damaging Het
Lamb3 T C 1: 193,330,067 V384A possibly damaging Het
Lmo2 T A 2: 103,970,700 L80Q possibly damaging Het
Lrrc37a T G 11: 103,503,126 E491A possibly damaging Het
Ninj1 T A 13: 49,193,812 M51K probably damaging Het
Olfr109 G A 17: 37,466,322 G39R probably damaging Het
Olfr742 C A 14: 50,515,643 N146K probably benign Het
Plppr3 T A 10: 79,867,004 T142S probably damaging Het
Rab2b T C 14: 52,268,696 D103G probably damaging Het
Rap1gap2 G T 11: 74,395,825 R550S probably damaging Het
Rbm33 A G 5: 28,352,625 N279D probably damaging Het
Rhox9 C T X: 37,901,376 G40R probably benign Het
Selplg G A 5: 113,819,441 T268I probably damaging Het
Slc20a1 T C 2: 129,208,200 M426T possibly damaging Het
Spata18 A T 5: 73,669,720 Y220F Het
Spns1 T C 7: 126,372,536 T281A probably benign Het
Sptan1 C T 2: 30,030,159 R2288C probably damaging Het
Tacstd2 T C 6: 67,535,399 D103G probably damaging Het
Tmem121 C T 12: 113,188,867 A235V probably benign Het
Try4 A G 6: 41,305,062 D194G probably damaging Het
Tyrp1 C A 4: 80,837,660 T222K probably damaging Het
Zfp57 T A 17: 37,009,893 V213D probably damaging Het
Zfy2 A T Y: 2,117,380 probably benign Het
Zkscan4 G A 13: 21,484,653 G454R not run Het
Other mutations in Klhl22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Klhl22 APN 16 17776462 missense probably benign 0.03
IGL01973:Klhl22 APN 16 17792711 missense probably benign 0.00
IGL02115:Klhl22 APN 16 17776595 missense probably damaging 0.99
IGL02383:Klhl22 APN 16 17776898 missense possibly damaging 0.60
IGL03381:Klhl22 APN 16 17792727 missense possibly damaging 0.71
R0562:Klhl22 UTSW 16 17792624 missense probably benign
R0811:Klhl22 UTSW 16 17792589 missense probably benign 0.01
R0812:Klhl22 UTSW 16 17792589 missense probably benign 0.01
R1661:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1665:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1732:Klhl22 UTSW 16 17777024 missense probably damaging 1.00
R1902:Klhl22 UTSW 16 17771787 missense probably damaging 1.00
R2042:Klhl22 UTSW 16 17792420 unclassified probably benign
R2083:Klhl22 UTSW 16 17776525 missense probably benign
R4368:Klhl22 UTSW 16 17789273 missense possibly damaging 0.94
R4860:Klhl22 UTSW 16 17777016 synonymous silent
R6413:Klhl22 UTSW 16 17789317 missense probably benign 0.01
R7031:Klhl22 UTSW 16 17777026 missense probably damaging 1.00
R7095:Klhl22 UTSW 16 17792750 missense probably damaging 0.98
R7378:Klhl22 UTSW 16 17776805 missense probably damaging 1.00
R7565:Klhl22 UTSW 16 17789284 missense probably damaging 1.00
R8153:Klhl22 UTSW 16 17792550 missense probably damaging 0.99
R8670:Klhl22 UTSW 16 17776463 missense probably damaging 0.99
R8732:Klhl22 UTSW 16 17771826 missense probably damaging 0.98
Z1088:Klhl22 UTSW 16 17776543 missense possibly damaging 0.86
Z1176:Klhl22 UTSW 16 17776696 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CAGAAGCTGCCTGGATTGAC -3'
(R):5'- TAGTCCTCGCTAGAGTTGTCAAAC -3'

Sequencing Primer
(F):5'- TGCCTGGATTGACCCTGGTC -3'
(R):5'- AGTTGTCAAACTCTTCCCAGTCAGAC -3'
Posted On2020-01-23